Gene detail

Detail information of GWHGAAZE023517

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004147702.1	8.26996E-34	PREDICTED: 60S ribosomal protein L23a-like [Cucumis sativus]
COG	YP_183953.1	2E-17	50S ribosomal protein L23
Swissprot	tr\|Q9AT35\|RL23A_DAUCA	3E-31	60S ribosomal protein L23a
trEMBL	tr\|A0A0A0KS61\|A0A0A0KS61_CUCSA	8E-34	Uncharacterized protein {ECO:0000313\|EMBL:KGN50526.1}
TAIR10	AT2G39460.2	1E-24	ribosomal protein L23AA

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	11234054	11234359	-
GWHAAZE00000007	mRNA	11234054	11234359	-
GWHAAZE00000007	exon	11234054	11234359	-
GWHAAZE00000007	CDS	11234054	11234359	-

Transcript Sequence
>GWHTAAZE023547 ATGAATTCCATGATTACACAAATTCCTTCTGCTCTGAAGGACGAGCTCGATTCCTACGAGGTCCTCAAATATCCCCTCGCTACTGAAGCTGCAATGAAGCAGATCATAGAAAACAACACGTTGGTCTTTATTGTGGACACGCGTGCCAACAAGAAAAATATAAGGGAGGCTTTTCAAAATATGTTCAAAATCAGGGCCAAGAAAGTAAATACTTTACTCAACTGTGACGGTACCAAGAAGGCTTTTCTTATGTTATCACCAGATTATAATGCTCTGGATGTTGCTAAAAAGATTAAGTTTATTTAG

Network for GWHGAAZE023517

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00276.21	Ribosomal_L23	21	81	5.20E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02893	RP-L23Ae, RPL23A	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	33.236
	SRR3591706	second leaf	90.515
	SRR3591707	mature leaf	72.302
	SRR3591708	Shoot apex	64.369
	SRR3591709	Stem	18.377
	SRR3591710	White floral bud	11.114
	SRR3591711	White flower	32.695
	SRR3591712	Green floral bud	28.322
	SRR3591713	Yellow flower	18.449
SRP173429	SRR8316895	Juvenile bud stage	21.382
	SRR8316896	Juvenile bud stage	19.331
	SRR8316897	Juvenile bud stage	18.006
	SRR8316894	Third green stage	9.744
	SRR8316900	Third green stage	28.817
	SRR8316901	Third green stage	24.184
	SRR8316898	Complete white stage	3.493
	SRR8316899	Complete white stage	17.824
	SRR8316903	Complete white stage	7.737
	SRR8316902	Silver flowering stage	6.205
	SRR8316904	Silver flowering stage	7.216
	SRR8316905	Silver flowering stage	3.796
	SRR8316906	Gold flowering stage	17.550
	SRR8316907	Gold flowering stage	16.453
	SRR8316908	Gold flowering stage	16.136
SRP132670	SRR6706286	Control	18.296
	SRR6706287	Light intensity 50%	19.199
	SRR6706288	Light intensity 20%	21.061
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.546
	CNS0095593	Slightly white alabastrum(diploid) 2	17.092
	CNS0095594	Slightly white alabastrum(diploid) 3	20.182
	CNS0095595	Whole white alabastrum(diploid) 2	12.563
	CNS0095596	Whole white alabastrum(diploid) 3	17.362
	CNS0095597	Whole white alabastrum(diploid) 4	11.362
	CNS0095598	Silvery flower (diploied) 1	14.445
	CNS0095599	Silvery flower (diploied) 2	11.850
	CNS0095600	Silvery flower (diploied) 3	10.013
	CNS0095601	Golden flower (diploid) 1	10.410
	CNS0095602	Golden flower (diploid) 2	11.863
	CNS0095603	Golden flower (diploid) 3	12.572
	CNS0095604	Slightly white alabastrum(tetraploid) 1	20.909
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.182
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.216
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.045
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.991
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.214
	CNS0095610	Silvery flower (tetraploid) 1	9.576
	CNS0095611	Silvery flower (tetraploid) 2	6.595
	CNS0095612	Silvery flower (tetraploid) 3	5.780
	CNS0095613	Golden flower (tetraploid) 1	8.899
	CNS0095614	Golden flower (tetraploid) 2	6.859
	CNS0095615	Golden flower (tetraploid) 3	10.510
CRA001975	CRR073297	Stem 1	8.020
	CRR073298	Stem 2	7.586
	CRR073299	Stem 3	5.067
	CRR073300	Leaf 1	5.662
	CRR073301	Leaf 2	4.331
	CRR073302	Leaf 3	3.736
	CRR073303	Juvenile bud 1	4.952
	CRR073304	Juvenile bud 2	7.379
	CRR073305	Juvenile bud 3	7.727
	CRR073306	Third green 1	6.128
	CRR073307	Third green 2	5.591
	CRR073308	Third green 3	4.472
	CRR073309	Second white 1	9.550
	CRR073310	Second white 2	10.259
	CRR073311	Second white 3	9.436
	CRR073312	Silver flowering 1	3.969
	CRR073313	Silver flowering 2	3.298
	CRR073314	Silver flowering 3	2.835
	CRR073315	Gold flowering 1	32.921
	CRR073316	Gold flowering 2	31.083
	CRR073317	Gold flowering 3	10.746
	CRR073318	Tawny withering 1	4.735
	CRR073319	Tawny withering 2	3.022
	CRR073320	Tawny withering 3	9.714