Gene detail

Detail information of GWHGAAZE023288

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP02459.1	1.4414E-103	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068U2R3\|A0A068U2R3_COFCA	5E-104	Coffea canephora DH200=94 genomic scaffold, scaffold_8 {ECO:0000313\|EMBL:CDP02459.1}
TAIR10	AT5G66930.3	3E-60	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	4406067	4408579	-
GWHAAZE00000007	mRNA	4406067	4408579	-
GWHAAZE00000007	exon	4406067	4406230	-
GWHAAZE00000007	exon	4406335	4406500	-
GWHAAZE00000007	exon	4407646	4407741	-
GWHAAZE00000007	exon	4408364	4408449	-
GWHAAZE00000007	exon	4408534	4408579	-
GWHAAZE00000007	CDS	4408534	4408579	-
GWHAAZE00000007	CDS	4408364	4408449	-
GWHAAZE00000007	CDS	4407646	4407741	-
GWHAAZE00000007	CDS	4406335	4406500	-
GWHAAZE00000007	CDS	4406067	4406230	-

Transcript Sequence
>GWHTAAZE023318 ATGCAATATTCTTGTTTTCCCTTCTTTTTATCTGAGCTTTCCATTGGCATTCTCCACACAATTTTGTTCCACAGGGCACTAGGTCTTGTGCGGCCCAAAGATATTGATTTAGAACTTTTTGAAATTACATATGTGCAATGTGGAGATCCAGAACTTGAAAAGAAAATAGATGAGAAGATTGACCAGTTCATTGATAGGGTAGAGAAACATCCCAACAAGAAAAATCAGATATGCCTATCTTTCTATGAAGTGAAAAACAAACAGGCGACATGGTTCACTAACAAAGTTGAACGTTTGCACTGGGAACAATGGTATATAAATTTAAATGTAGCACAGCACCCGAAACCACATTCTGGCAAGTCTCATCATTCCAAAGTAGTTGTAGGCCCTGCAGACAGTGCATCTGAAGAGAGAAGCGTCCGCCGGGCAGCACTCGAAGCATCATTACGGGAGGTTTTGTTTCAGATAATAAAATTCGTGAATGAGAAAAAGGATCACGTCCCCTCCATACCACCAAATATTGATGGTGTCTCATTTCCCTACGAGATCACTATTTCA

Network for GWHGAAZE023288

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07855.13	ATG101	12	171	1.40E-45

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19730	ATG101	Autophagy - animal	map04140
		Autophagy - other	map04136
		Longevity regulating pathway	map04211

Gene Ontology

GO term	Ontology	Name
GO:0006914	biological_process	autophagy

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	28.954
	SRR3591706	second leaf	15.766
	SRR3591707	mature leaf	23.025
	SRR3591708	Shoot apex	23.487
	SRR3591709	Stem	31.696
	SRR3591710	White floral bud	31.239
	SRR3591711	White flower	32.218
	SRR3591712	Green floral bud	28.353
	SRR3591713	Yellow flower	41.138
SRP173429	SRR8316895	Juvenile bud stage	16.875
	SRR8316896	Juvenile bud stage	27.430
	SRR8316897	Juvenile bud stage	14.052
	SRR8316894	Third green stage	10.376
	SRR8316900	Third green stage	23.768
	SRR8316901	Third green stage	27.448
	SRR8316898	Complete white stage	20.701
	SRR8316899	Complete white stage	59.755
	SRR8316903	Complete white stage	28.835
	SRR8316902	Silver flowering stage	20.265
	SRR8316904	Silver flowering stage	28.578
	SRR8316905	Silver flowering stage	14.377
	SRR8316906	Gold flowering stage	53.780
	SRR8316907	Gold flowering stage	45.698
	SRR8316908	Gold flowering stage	46.952
SRP132670	SRR6706286	Control	27.402
	SRR6706287	Light intensity 50%	27.287
	SRR6706288	Light intensity 20%	26.510
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.753
	CNS0095593	Slightly white alabastrum(diploid) 2	24.384
	CNS0095594	Slightly white alabastrum(diploid) 3	18.830
	CNS0095595	Whole white alabastrum(diploid) 2	20.566
	CNS0095596	Whole white alabastrum(diploid) 3	16.639
	CNS0095597	Whole white alabastrum(diploid) 4	21.618
	CNS0095598	Silvery flower (diploied) 1	19.087
	CNS0095599	Silvery flower (diploied) 2	25.394
	CNS0095600	Silvery flower (diploied) 3	37.797
	CNS0095601	Golden flower (diploid) 1	27.678
	CNS0095602	Golden flower (diploid) 2	40.171
	CNS0095603	Golden flower (diploid) 3	34.461
	CNS0095604	Slightly white alabastrum(tetraploid) 1	26.777
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.821
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.665
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.945
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.787
	CNS0095609	Whole white alabastrum(tetraploid) 3	34.239
	CNS0095610	Silvery flower (tetraploid) 1	53.833
	CNS0095611	Silvery flower (tetraploid) 2	58.953
	CNS0095612	Silvery flower (tetraploid) 3	48.174
	CNS0095613	Golden flower (tetraploid) 1	45.282
	CNS0095614	Golden flower (tetraploid) 2	55.512
	CNS0095615	Golden flower (tetraploid) 3	55.499
CRA001975	CRR073297	Stem 1	28.817
	CRR073298	Stem 2	26.788
	CRR073299	Stem 3	25.955
	CRR073300	Leaf 1	39.624
	CRR073301	Leaf 2	37.237
	CRR073302	Leaf 3	28.886
	CRR073303	Juvenile bud 1	29.526
	CRR073304	Juvenile bud 2	20.646
	CRR073305	Juvenile bud 3	24.406
	CRR073306	Third green 1	12.695
	CRR073307	Third green 2	13.642
	CRR073308	Third green 3	15.386
	CRR073309	Second white 1	11.321
	CRR073310	Second white 2	19.251
	CRR073311	Second white 3	17.979
	CRR073312	Silver flowering 1	16.075
	CRR073313	Silver flowering 2	12.920
	CRR073314	Silver flowering 3	9.973
	CRR073315	Gold flowering 1	13.764
	CRR073316	Gold flowering 2	24.811
	CRR073317	Gold flowering 3	16.154
	CRR073318	Tawny withering 1	26.678
	CRR073319	Tawny withering 2	22.777
	CRR073320	Tawny withering 3	19.288