Gene detail

Detail information of GWHGAAZE023157

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002276349.2	1.67184E-69	PREDICTED: uncharacterized protein LOC100242725 [Vitis vinifera]
trEMBL	tr\|D7SPM3\|D7SPM3_VITVI	6E-70	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI17602.3}
TAIR10	AT4G23620.2	2E-46	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	831647	832117	-
GWHAAZE00000007	mRNA	831647	832117	-
GWHAAZE00000007	exon	831647	832117	-
GWHAAZE00000007	CDS	831647	832117	-

Transcript Sequence
>GWHTAAZE023187 ATGTGGATGTCTCGCCAATTACTCACCAAAACCCTTCATGTCCGATACTTGTCCCAATCCTCTGTTGCAGCCCTCCTTCAAGACGTCGAAGCCCCCTTAACCTACCTTGATGGCCTCCCCAAACCAGATCCCAAGTTCGATGAGACAATTCACGCTATTCCACGGTCCCTCTCTGGCAAGAACATCTCTGCCAAGGAGAGAAAAGCTGGCCGTGTCCCCAGCATAGTCTTCGAGCAGGAGGACGGGCAGCACGGCGGCAACAAGCGACTCATCTCTGTCCAGACCAATCAGATCAAGAAGTTAGTCAATCACCTTGGCCGTTCCTTTTTCCTTTCCAGGCTATTTGATCTTGAGGTCCATCCTGATTTTGAATCTCAGGATCTCATTGAGAAGGTTCGCGTTTTGCCTCGCAAGGTATGGTATTTGATTCGCATACTTCTACTTCAGGGTTTCAAAATATGCGCTGTTTGA

Network for GWHGAAZE023157

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01386.20	Ribosomal_L25p	51	128	1.60E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02897	RP-L25, rplY	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0008097	molecular_function	5S rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.825
	SRR3591706	second leaf	8.141
	SRR3591707	mature leaf	8.879
	SRR3591708	Shoot apex	17.557
	SRR3591709	Stem	8.478
	SRR3591710	White floral bud	13.527
	SRR3591711	White flower	13.307
	SRR3591712	Green floral bud	17.475
	SRR3591713	Yellow flower	11.500
SRP173429	SRR8316895	Juvenile bud stage	7.674
	SRR8316896	Juvenile bud stage	9.806
	SRR8316897	Juvenile bud stage	5.067
	SRR8316894	Third green stage	4.211
	SRR8316900	Third green stage	10.857
	SRR8316901	Third green stage	10.459
	SRR8316898	Complete white stage	2.167
	SRR8316899	Complete white stage	10.869
	SRR8316903	Complete white stage	2.595
	SRR8316902	Silver flowering stage	2.548
	SRR8316904	Silver flowering stage	3.620
	SRR8316905	Silver flowering stage	1.411
	SRR8316906	Gold flowering stage	4.594
	SRR8316907	Gold flowering stage	9.317
	SRR8316908	Gold flowering stage	2.726
SRP132670	SRR6706286	Control	16.974
	SRR6706287	Light intensity 50%	18.886
	SRR6706288	Light intensity 20%	19.468
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.399
	CNS0095593	Slightly white alabastrum(diploid) 2	9.290
	CNS0095594	Slightly white alabastrum(diploid) 3	6.611
	CNS0095595	Whole white alabastrum(diploid) 2	3.771
	CNS0095596	Whole white alabastrum(diploid) 3	4.477
	CNS0095597	Whole white alabastrum(diploid) 4	2.897
	CNS0095598	Silvery flower (diploied) 1	2.158
	CNS0095599	Silvery flower (diploied) 2	1.832
	CNS0095600	Silvery flower (diploied) 3	5.263
	CNS0095601	Golden flower (diploid) 1	3.381
	CNS0095602	Golden flower (diploid) 2	4.378
	CNS0095603	Golden flower (diploid) 3	3.419
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.789
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.106
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.233
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.052
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.005
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.470
	CNS0095610	Silvery flower (tetraploid) 1	4.668
	CNS0095611	Silvery flower (tetraploid) 2	6.845
	CNS0095612	Silvery flower (tetraploid) 3	5.562
	CNS0095613	Golden flower (tetraploid) 1	1.989
	CNS0095614	Golden flower (tetraploid) 2	4.458
	CNS0095615	Golden flower (tetraploid) 3	2.982
CRA001975	CRR073297	Stem 1	16.727
	CRR073298	Stem 2	17.881
	CRR073299	Stem 3	20.571
	CRR073300	Leaf 1	15.657
	CRR073301	Leaf 2	16.751
	CRR073302	Leaf 3	19.695
	CRR073303	Juvenile bud 1	15.830
	CRR073304	Juvenile bud 2	13.586
	CRR073305	Juvenile bud 3	20.894
	CRR073306	Third green 1	1.998
	CRR073307	Third green 2	3.130
	CRR073308	Third green 3	3.405
	CRR073309	Second white 1	6.863
	CRR073310	Second white 2	7.405
	CRR073311	Second white 3	4.659
	CRR073312	Silver flowering 1	2.299
	CRR073313	Silver flowering 2	7.675
	CRR073314	Silver flowering 3	2.484
	CRR073315	Gold flowering 1	5.895
	CRR073316	Gold flowering 2	6.416
	CRR073317	Gold flowering 3	10.525
	CRR073318	Tawny withering 1	8.913
	CRR073319	Tawny withering 2	10.204
	CRR073320	Tawny withering 3	8.622