Gene detail

Detail information of GWHGAAZE023119

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010250452.1	2.21713E-57	PREDICTED: probable protein S-acyltransferase 7 [Nelumbo nucifera]
Swissprot	tr\|Q9SB58\|ZDH19_ARATH	2E-45	Protein S-acyltransferase 8
trEMBL	tr\|F6HJ79\|F6HJ79_VITVI	1E-57	S-acyltransferase {ECO:0000256\|RuleBase:RU079119}
TAIR10	AT4G24630.1	3E-39	DHHC-type zinc finger family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	83895291	83897033	+
GWHAAZE00000006	mRNA	83895291	83897033	+
GWHAAZE00000006	exon	83895291	83895434	+
GWHAAZE00000006	exon	83895875	83896183	+
GWHAAZE00000006	exon	83896884	83897033	+
GWHAAZE00000006	CDS	83895291	83895434	+
GWHAAZE00000006	CDS	83895875	83896183	+
GWHAAZE00000006	CDS	83896884	83897033	+

Transcript Sequence
>GWHTAAZE023149 ATGGCTTTCCATTATTTTAGCTCGCCACTTTCTTCAGCTCGAGTAAACACAATGGTGCCTTGCACGTGCTACTTTAGCGTCACGCTGTCACTCCTTGGACATGTGGCTGATGTAAGATTGCACACCACTGTTAACGATATTCGTATTATTATTCTTCTCTTCCTCACTTCTGGAAGAGACCCTGGCATTATTCCTCGGAATCCACATCCTCCAGAACCAGATGACGAAGGTGATACCTCTAGTATCTCTACAGACTGGACCGGAAGTTTGAGTGGTGCTCCAAGTATACCACCTACAAAAAATGTTATTGTGAATGGCATGGTTGTCAGGGTCAAATACTGCCAAACGTGCATGCTGTATCGCCCCCCTAGATGCTCTCATTGCTCAGTATGCAACAACTGTGTTGAGCGCTTTGATCACCATTGCCCTTGGGTGGGGCAATGTATTGGCAAGACTTTGAACCATTTGGTGAAGAAAGACAGGGAAAGAAAGAAAAACACAGAGGTGTTGCCTTCCTCTCCCCCAAACCACACCATCCCAAACAACAATTTCTGGCCAACTGTGGGGCTGGATGGCCAAACACCCGCAGCGGCATACTGTTGA

Network for GWHGAAZE023119

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01529.21	DHHC	112	151	3.20E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16675	ZDHHC9_14_18	Hippo signaling pathway - fly	map04391

Gene Ontology

GO term	Ontology	Name
GO:0016409	molecular_function	palmitoyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.519
	SRR3591706	second leaf	1.327
	SRR3591707	mature leaf	1.758
	SRR3591708	Shoot apex	1.616
	SRR3591709	Stem	1.735
	SRR3591710	White floral bud	6.447
	SRR3591711	White flower	1.225
	SRR3591712	Green floral bud	7.975
	SRR3591713	Yellow flower	0.689
SRP173429	SRR8316895	Juvenile bud stage	3.212
	SRR8316896	Juvenile bud stage	4.692
	SRR8316897	Juvenile bud stage	1.296
	SRR8316894	Third green stage	2.660
	SRR8316900	Third green stage	5.458
	SRR8316901	Third green stage	5.828
	SRR8316898	Complete white stage	1.453
	SRR8316899	Complete white stage	4.594
	SRR8316903	Complete white stage	2.876
	SRR8316902	Silver flowering stage	1.950
	SRR8316904	Silver flowering stage	3.043
	SRR8316905	Silver flowering stage	2.082
	SRR8316906	Gold flowering stage	4.747
	SRR8316907	Gold flowering stage	4.792
	SRR8316908	Gold flowering stage	1.129
SRP132670	SRR6706286	Control	7.703
	SRR6706287	Light intensity 50%	7.382
	SRR6706288	Light intensity 20%	7.394
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.638
	CNS0095593	Slightly white alabastrum(diploid) 2	4.562
	CNS0095594	Slightly white alabastrum(diploid) 3	6.856
	CNS0095595	Whole white alabastrum(diploid) 2	9.827
	CNS0095596	Whole white alabastrum(diploid) 3	9.107
	CNS0095597	Whole white alabastrum(diploid) 4	6.364
	CNS0095598	Silvery flower (diploied) 1	5.279
	CNS0095599	Silvery flower (diploied) 2	5.056
	CNS0095600	Silvery flower (diploied) 3	6.825
	CNS0095601	Golden flower (diploid) 1	4.832
	CNS0095602	Golden flower (diploid) 2	5.492
	CNS0095603	Golden flower (diploid) 3	4.093
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.117
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.582
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.796
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.019
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.016
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.756
	CNS0095610	Silvery flower (tetraploid) 1	0.926
	CNS0095611	Silvery flower (tetraploid) 2	1.126
	CNS0095612	Silvery flower (tetraploid) 3	1.497
	CNS0095613	Golden flower (tetraploid) 1	0.339
	CNS0095614	Golden flower (tetraploid) 2	0.276
	CNS0095615	Golden flower (tetraploid) 3	0.870
CRA001975	CRR073297	Stem 1	7.042
	CRR073298	Stem 2	5.559
	CRR073299	Stem 3	2.419
	CRR073300	Leaf 1	9.643
	CRR073301	Leaf 2	8.561
	CRR073302	Leaf 3	3.146
	CRR073303	Juvenile bud 1	3.722
	CRR073304	Juvenile bud 2	3.611
	CRR073305	Juvenile bud 3	2.138
	CRR073306	Third green 1	1.108
	CRR073307	Third green 2	2.320
	CRR073308	Third green 3	1.290
	CRR073309	Second white 1	0.911
	CRR073310	Second white 2	1.137
	CRR073311	Second white 3	0.656
	CRR073312	Silver flowering 1	1.910
	CRR073313	Silver flowering 2	0.452
	CRR073314	Silver flowering 3	0.743
	CRR073315	Gold flowering 1	1.621
	CRR073316	Gold flowering 2	2.582
	CRR073317	Gold flowering 3	1.380
	CRR073318	Tawny withering 1	3.214
	CRR073319	Tawny withering 2	6.497
	CRR073320	Tawny withering 3	3.945