Gene detail

Detail information of GWHGAAZE023095

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010907663.1	3.29938E-24	PREDICTED: glycerophosphodiester phosphodiesterase GDPD1, chloroplastic-like [Elaeis guineensis]
Swissprot	tr\|Q9FLM1\|GDPD2_ARATH	2E-17	Glycerophosphodiester phosphodiesterase GDPD2 {ECO:0000305}
trEMBL	tr\|W5D7E3\|W5D7E3_WHEAT	2E-23	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Traes_3DL_01383BD6A.2}
TAIR10	AT5G43300.1	1E-11	PLC-like phosphodiesterases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	83380472	83382173	+
GWHAAZE00000006	mRNA	83380472	83382173	+
GWHAAZE00000006	exon	83380472	83380570	+
GWHAAZE00000006	exon	83380663	83380743	+
GWHAAZE00000006	exon	83380995	83381057	+
GWHAAZE00000006	exon	83381180	83381275	+
GWHAAZE00000006	exon	83381935	83382173	+
GWHAAZE00000006	CDS	83380472	83380570	+
GWHAAZE00000006	CDS	83380663	83380743	+
GWHAAZE00000006	CDS	83380995	83381057	+
GWHAAZE00000006	CDS	83381180	83381275	+
GWHAAZE00000006	CDS	83381935	83382075	+
GWHAAZE00000006	three_prime_UTR	83382076	83382173	+

Transcript Sequence
>GWHTAAZE023125 ATGACTGCCCAGTCATTTTCCACGACAACTTCATCCTTACTCAAGAGAAGGTTAGTTTTCCTTTTTAATCTCTCCCTCTACGCGCATCCGTTAATTAACGGTGCAATAGCGGAGAAAAGAGTTACGGGCCTAACTCTAGATGAGTTTCTTTCTTATGGACCACAAAGGGAGCCTAGTAATTTCGATGACAACTTGGCCTATAAAGAGGATGAACTCGCACTTGCTGTGCAAGCAGTCTTGCAGGTGGTATTTGATTGTGCCAAAGATAGACCTATCATCTTCTCTAGCTTTCAACCTGATGCAGCACAGTCGATCCAGAAGCTGCAAACTACCTACCCTCATTTAATGGGTGTTGAAGGGGTGATAGTCGACTTAGTTCAAGAGATAACAGATCAGGTGGTTTCGGACTTGACCAATAAAAAGGTGATGGCGGCGGCAAAAATGGGGAGTGCTGGCAGCATGAACTCTCGCTTCTTTTAAAGCTCTTTCCAGACTTTATAAAACCTTGATCCATCGATATCTTCCAATGGCCGGAGATCAACTACTTGATCATCTCCAGTGTACGTACGTACAGTAAT

Network for GWHGAAZE023095

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03009.18	GDPD	69	127	2.60E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K18696	GDE1	Glycerophospholipid metabolism	map00564

Gene Ontology

GO term	Ontology	Name
GO:0006629	biological_process	lipid metabolic process
GO:0008081	molecular_function	phosphoric diester hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.815
	SRR3591707	mature leaf	1.184
	SRR3591708	Shoot apex	0.185
	SRR3591709	Stem	0.142
	SRR3591710	White floral bud	4.564
	SRR3591711	White flower	0.138
	SRR3591712	Green floral bud	0.788
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.188
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.166
	SRR8316901	Third green stage	0.232
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.060
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.024
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.406
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.115
SRP132670	SRR6706286	Control	0.127
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.237
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.058
	CNS0095613	Golden flower (tetraploid) 1	0.112
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.263
	CRR073298	Stem 2	0.073
	CRR073299	Stem 3	0.053
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.061
	CRR073302	Leaf 3	0.075
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.078
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.066
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.496
	CRR073316	Gold flowering 2	1.694
	CRR073317	Gold flowering 3	0.019
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000