Gene detail

Detail information of GWHGAAZE022700

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009605055.1	6.29115E-33	PREDICTED: ASC1-like protein [Nicotiana tomentosiformis]
Swissprot	tr\|Q8W4Y5\|ASCL_SOLLC	8E-35	ASC1-like protein
trEMBL	tr\|M1CCP9\|M1CCP9_SOLTU	3E-33	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400064667}
TAIR10	AT1G13580.3	2E-25	LAG1 longevity assurance homolog 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	77133407	77133781	-
GWHAAZE00000006	mRNA	77133407	77133781	-
GWHAAZE00000006	exon	77133407	77133420	-
GWHAAZE00000006	exon	77133506	77133690	-
GWHAAZE00000006	exon	77133771	77133781	-
GWHAAZE00000006	CDS	77133771	77133781	-
GWHAAZE00000006	CDS	77133506	77133690	-
GWHAAZE00000006	CDS	77133407	77133420	-

Transcript Sequence
>GWHTAAZE022730 ATGTTGAAGAGTTATGAAGTTCTGAAGACTTTGGACAAGGAGAAGCACATGGTGGATGGACCAATCTACTACTATGTGTTCAATACTCTTCTTTTCTGCTTGCTGGTTCTTCACATTTACTGGTGGGTATTGATGTATCGGATGCTTGTTAAACAAATCCAAGCAAGAGGCCAGCTTAGCGAAGATGTTCGATCTGGAATGAGATTATGA

Network for GWHGAAZE022700

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K23727	CERS5_6, LASS5_6	Metabolic pathways	map01100
		Sphingolipid metabolism	map00600
		Sphingolipid signaling pathway	map04071

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	51.045
	SRR3591706	second leaf	22.597
	SRR3591707	mature leaf	35.791
	SRR3591708	Shoot apex	39.296
	SRR3591709	Stem	77.838
	SRR3591710	White floral bud	56.574
	SRR3591711	White flower	42.979
	SRR3591712	Green floral bud	61.750
	SRR3591713	Yellow flower	42.978
SRP173429	SRR8316895	Juvenile bud stage	24.313
	SRR8316896	Juvenile bud stage	33.018
	SRR8316897	Juvenile bud stage	12.433
	SRR8316894	Third green stage	14.729
	SRR8316900	Third green stage	51.072
	SRR8316901	Third green stage	48.069
	SRR8316898	Complete white stage	19.572
	SRR8316899	Complete white stage	87.684
	SRR8316903	Complete white stage	33.758
	SRR8316902	Silver flowering stage	17.407
	SRR8316904	Silver flowering stage	26.667
	SRR8316905	Silver flowering stage	10.068
	SRR8316906	Gold flowering stage	43.760
	SRR8316907	Gold flowering stage	32.017
	SRR8316908	Gold flowering stage	39.519
SRP132670	SRR6706286	Control	5.547
	SRR6706287	Light intensity 50%	7.095
	SRR6706288	Light intensity 20%	8.134
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	38.644
	CNS0095593	Slightly white alabastrum(diploid) 2	47.898
	CNS0095594	Slightly white alabastrum(diploid) 3	46.147
	CNS0095595	Whole white alabastrum(diploid) 2	52.592
	CNS0095596	Whole white alabastrum(diploid) 3	46.617
	CNS0095597	Whole white alabastrum(diploid) 4	50.215
	CNS0095598	Silvery flower (diploied) 1	47.933
	CNS0095599	Silvery flower (diploied) 2	42.249
	CNS0095600	Silvery flower (diploied) 3	46.865
	CNS0095601	Golden flower (diploid) 1	36.869
	CNS0095602	Golden flower (diploid) 2	46.018
	CNS0095603	Golden flower (diploid) 3	38.902
	CNS0095604	Slightly white alabastrum(tetraploid) 1	53.566
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.968
	CNS0095606	Slightly white alabastrum(tetraploid) 3	61.110
	CNS0095607	Whole white alabastrum(tetraploid) 1	54.048
	CNS0095608	Whole white alabastrum(tetraploid) 2	36.009
	CNS0095609	Whole white alabastrum(tetraploid) 3	38.870
	CNS0095610	Silvery flower (tetraploid) 1	45.576
	CNS0095611	Silvery flower (tetraploid) 2	57.750
	CNS0095612	Silvery flower (tetraploid) 3	32.474
	CNS0095613	Golden flower (tetraploid) 1	37.653
	CNS0095614	Golden flower (tetraploid) 2	46.452
	CNS0095615	Golden flower (tetraploid) 3	30.498
CRA001975	CRR073297	Stem 1	11.721
	CRR073298	Stem 2	12.334
	CRR073299	Stem 3	9.263
	CRR073300	Leaf 1	18.562
	CRR073301	Leaf 2	9.165
	CRR073302	Leaf 3	11.224
	CRR073303	Juvenile bud 1	14.549
	CRR073304	Juvenile bud 2	6.728
	CRR073305	Juvenile bud 3	18.688
	CRR073306	Third green 1	6.532
	CRR073307	Third green 2	4.480
	CRR073308	Third green 3	1.934
	CRR073309	Second white 1	6.713
	CRR073310	Second white 2	8.684
	CRR073311	Second white 3	4.880
	CRR073312	Silver flowering 1	4.391
	CRR073313	Silver flowering 2	6.999
	CRR073314	Silver flowering 3	3.130
	CRR073315	Gold flowering 1	12.641
	CRR073316	Gold flowering 2	9.303
	CRR073317	Gold flowering 3	5.758
	CRR073318	Tawny withering 1	17.981
	CRR073319	Tawny withering 2	19.023
	CRR073320	Tawny withering 3	16.773