Gene detail

Detail information of GWHGAAZE022630

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP00628.1	1.16633E-58	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068TZ53\|A0A068TZ53_COFCA	4E-59	Coffea canephora DH200=94 genomic scaffold, scaffold_5 {ECO:0000313\|EMBL:CDP00628.1}
TAIR10	AT1G25420.1	7E-41	Regulator of Vps4 activity in the MVB pathway protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	75712308	75713342	+
GWHAAZE00000006	mRNA	75712308	75713342	+
GWHAAZE00000006	exon	75712308	75712324	+
GWHAAZE00000006	exon	75712755	75712926	+
GWHAAZE00000006	exon	75713041	75713181	+
GWHAAZE00000006	exon	75713268	75713342	+
GWHAAZE00000006	CDS	75712308	75712324	+
GWHAAZE00000006	CDS	75712755	75712926	+
GWHAAZE00000006	CDS	75713041	75713181	+
GWHAAZE00000006	CDS	75713268	75713342	+

Transcript Sequence
>GWHTAAZE022660 ATGGCATATAATACACAGGAATGTCCTTCTGAGTTGCGGGAAGCAGTTGCAAGCGTAATCTTTGCTGCTCCCCGCTGTTCAGATTTGCCTGATCTTATGCACATCAGAAATTTGTTTGCTGCAAAATATGGGAAGGAGTTCATAGCCGCTGCTACAGAGCTTCGTCCTGATACTAGTGTCAACCGTACAATAATTGAGAAGCTTTCCATCAGTGCTCCATCCGCAGAAATAAGGCTCAAGTTGTTGAAGGAAATTGCTCAAGAGCACAATGTGGAATGGGATTCTTCCACAACTGAAGCAGAATTCAGTAAAAAACCAGAGGATCTTCTGATCACCATCCACTTGTTAAAGTCCTCTGAAGGTGCAAAATCTAATTCTGGAAATGGTGATTGCCAGAAGTTATAG

Network for GWHGAAZE022630

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03398.15	Ist1	5	92	2.60E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19476	IST1	Endocytosis	map04144

Gene Ontology

GO term	Ontology	Name
GO:0015031	biological_process	protein transport

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.303
	SRR3591706	second leaf	16.321
	SRR3591707	mature leaf	13.730
	SRR3591708	Shoot apex	16.433
	SRR3591709	Stem	32.367
	SRR3591710	White floral bud	27.778
	SRR3591711	White flower	30.445
	SRR3591712	Green floral bud	22.958
	SRR3591713	Yellow flower	37.756
SRP173429	SRR8316895	Juvenile bud stage	17.039
	SRR8316896	Juvenile bud stage	22.989
	SRR8316897	Juvenile bud stage	13.724
	SRR8316894	Third green stage	10.149
	SRR8316900	Third green stage	36.824
	SRR8316901	Third green stage	29.632
	SRR8316898	Complete white stage	28.094
	SRR8316899	Complete white stage	45.675
	SRR8316903	Complete white stage	39.274
	SRR8316902	Silver flowering stage	17.373
	SRR8316904	Silver flowering stage	27.159
	SRR8316905	Silver flowering stage	15.238
	SRR8316906	Gold flowering stage	51.546
	SRR8316907	Gold flowering stage	49.788
	SRR8316908	Gold flowering stage	52.215
SRP132670	SRR6706286	Control	36.833
	SRR6706287	Light intensity 50%	37.029
	SRR6706288	Light intensity 20%	37.827
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.651
	CNS0095593	Slightly white alabastrum(diploid) 2	22.468
	CNS0095594	Slightly white alabastrum(diploid) 3	18.182
	CNS0095595	Whole white alabastrum(diploid) 2	18.607
	CNS0095596	Whole white alabastrum(diploid) 3	18.863
	CNS0095597	Whole white alabastrum(diploid) 4	16.158
	CNS0095598	Silvery flower (diploied) 1	28.220
	CNS0095599	Silvery flower (diploied) 2	26.445
	CNS0095600	Silvery flower (diploied) 3	45.437
	CNS0095601	Golden flower (diploid) 1	25.867
	CNS0095602	Golden flower (diploid) 2	35.571
	CNS0095603	Golden flower (diploid) 3	38.002
	CNS0095604	Slightly white alabastrum(tetraploid) 1	24.395
	CNS0095605	Slightly white alabastrum(tetraploid) 2	21.182
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.121
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.643
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.679
	CNS0095609	Whole white alabastrum(tetraploid) 3	22.917
	CNS0095610	Silvery flower (tetraploid) 1	46.479
	CNS0095611	Silvery flower (tetraploid) 2	56.119
	CNS0095612	Silvery flower (tetraploid) 3	49.188
	CNS0095613	Golden flower (tetraploid) 1	31.432
	CNS0095614	Golden flower (tetraploid) 2	33.395
	CNS0095615	Golden flower (tetraploid) 3	44.396
CRA001975	CRR073297	Stem 1	37.937
	CRR073298	Stem 2	34.065
	CRR073299	Stem 3	37.475
	CRR073300	Leaf 1	52.252
	CRR073301	Leaf 2	47.184
	CRR073302	Leaf 3	50.868
	CRR073303	Juvenile bud 1	59.610
	CRR073304	Juvenile bud 2	59.608
	CRR073305	Juvenile bud 3	58.341
	CRR073306	Third green 1	50.399
	CRR073307	Third green 2	57.611
	CRR073308	Third green 3	45.741
	CRR073309	Second white 1	37.324
	CRR073310	Second white 2	39.739
	CRR073311	Second white 3	33.339
	CRR073312	Silver flowering 1	29.837
	CRR073313	Silver flowering 2	34.836
	CRR073314	Silver flowering 3	28.314
	CRR073315	Gold flowering 1	40.372
	CRR073316	Gold flowering 2	42.374
	CRR073317	Gold flowering 3	34.134
	CRR073318	Tawny withering 1	42.258
	CRR073319	Tawny withering 2	32.492
	CRR073320	Tawny withering 3	39.393