Gene detail

Detail information of GWHGAAZE022610

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009630453.1	2.67133E-73	PREDICTED: auxin-responsive protein IAA32-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q8RYC6\|IAA32_ARATH	4E-45	Auxin-responsive protein IAA32
trEMBL	tr\|A0A068TXP1\|A0A068TXP1_COFCA	1E-72	Auxin-responsive protein {ECO:0000256\|RuleBase:RU004549}
TAIR10	AT2G01200.2	1E-36	indole-3-acetic acid inducible 32

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	75310637	75311510	+
GWHAAZE00000006	mRNA	75310637	75311510	+
GWHAAZE00000006	exon	75310637	75310718	+
GWHAAZE00000006	exon	75310840	75311079	+
GWHAAZE00000006	exon	75311178	75311286	+
GWHAAZE00000006	exon	75311420	75311510	+
GWHAAZE00000006	CDS	75310637	75310718	+
GWHAAZE00000006	CDS	75310840	75311079	+
GWHAAZE00000006	CDS	75311178	75311286	+
GWHAAZE00000006	CDS	75311420	75311510	+

Transcript Sequence
>GWHTAAZE022640 TATTACCAAGATGGTAGTATAATTGACTTGGGTCTTAGCCTTAGAGCCTTGCAGCCACAAGCATATCATCCATCTCCACGCGTTTCAGACGAATACGGTGAACTGATGGATTGGCACCAGTTGCACCCCCAGAAAGGTTCAAAATTCGAGTATCCAATAAATGTAACCGAGGATTCTGCTGACGAAACAGAGGGAGTACAGAGCAAACAGAGGTGGGATTATGTTAAGGTTAACATGGATGGGGTAATTGTGGGTCGGAAAATTTGTATTGGTGACCATTCGGATTACTCAAGCCTAGCTATTACACTTGAAGGCATGTTCGGAAGACAATCCATATCAGGGTTAAGGCTATTCCAGGCCGGGTCAGAGTTCTGCTTGTTTTACAAGGACAGAGATGAGCAATGGAGGACTGTTGGTGATGTCCCATGGAAGATATTTGTAGATTGCGTAAAGCGGCTGAGGATTGTCCACAAGAATGAATTATTTGCTTCCTCTTCGTCAGCAGCAGCAGCATTTGCTTAA

Network for GWHGAAZE022610

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02309.17	AUX_IAA	59	161	8.60E-24

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AUX/IAA

KEGG pathway

KO	Enzyme	pathway	mapID
K14484	IAA	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.647
	SRR3591706	second leaf	0.320
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	4.434
	SRR3591709	Stem	0.405
	SRR3591710	White floral bud	0.103
	SRR3591711	White flower	1.210
	SRR3591712	Green floral bud	1.484
	SRR3591713	Yellow flower	0.248
SRP173429	SRR8316895	Juvenile bud stage	21.312
	SRR8316896	Juvenile bud stage	18.794
	SRR8316897	Juvenile bud stage	6.069
	SRR8316894	Third green stage	4.178
	SRR8316900	Third green stage	3.568
	SRR8316901	Third green stage	6.206
	SRR8316898	Complete white stage	2.426
	SRR8316899	Complete white stage	9.607
	SRR8316903	Complete white stage	2.061
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.522
	SRR8316905	Silver flowering stage	0.170
	SRR8316906	Gold flowering stage	0.062
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	10.229
	SRR6706287	Light intensity 50%	9.897
	SRR6706288	Light intensity 20%	11.326
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.532
	CNS0095593	Slightly white alabastrum(diploid) 2	13.335
	CNS0095594	Slightly white alabastrum(diploid) 3	18.793
	CNS0095595	Whole white alabastrum(diploid) 2	10.711
	CNS0095596	Whole white alabastrum(diploid) 3	2.955
	CNS0095597	Whole white alabastrum(diploid) 4	5.913
	CNS0095598	Silvery flower (diploied) 1	8.185
	CNS0095599	Silvery flower (diploied) 2	5.989
	CNS0095600	Silvery flower (diploied) 3	0.949
	CNS0095601	Golden flower (diploid) 1	6.978
	CNS0095602	Golden flower (diploid) 2	2.256
	CNS0095603	Golden flower (diploid) 3	2.189
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.222
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.654
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.595
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.547
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.972
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.126
	CNS0095610	Silvery flower (tetraploid) 1	0.239
	CNS0095611	Silvery flower (tetraploid) 2	0.750
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.469
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	16.951
	CRR073298	Stem 2	15.288
	CRR073299	Stem 3	15.519
	CRR073300	Leaf 1	5.175
	CRR073301	Leaf 2	10.285
	CRR073302	Leaf 3	5.197
	CRR073303	Juvenile bud 1	3.459
	CRR073304	Juvenile bud 2	2.171
	CRR073305	Juvenile bud 3	5.466
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.504
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.102
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.686
	CRR073316	Gold flowering 2	0.745
	CRR073317	Gold flowering 3	1.003
	CRR073318	Tawny withering 1	0.113
	CRR073319	Tawny withering 2	0.793
	CRR073320	Tawny withering 3	0.000