Gene detail

Detail information of GWHGAAZE022528

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009607528.1	1.71043E-23	PREDICTED: probable inactive receptor kinase At1g48480 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9LP77\|Y1848_ARATH	1E-20	Probable inactive receptor kinase At1g48480 (Precursor)
trEMBL	tr\|A0A061FVY1\|A0A061FVY1_THECC	3E-23	Receptor-like kinase 1 {ECO:0000313\|EMBL:EOY21411.1}
TAIR10	AT1G48480.1	2E-18	receptor-like kinase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	74004329	74004817	+
GWHAAZE00000006	mRNA	74004329	74004817	+
GWHAAZE00000006	exon	74004329	74004362	+
GWHAAZE00000006	exon	74004451	74004564	+
GWHAAZE00000006	exon	74004639	74004817	+
GWHAAZE00000006	CDS	74004329	74004362	+
GWHAAZE00000006	CDS	74004451	74004564	+
GWHAAZE00000006	CDS	74004639	74004817	+

Transcript Sequence
>GWHTAAZE022558 ATGCCCAACGGAAGCTCGTTCACGCTTTTGCACGGAATCCAAGGGACAAACAAGACATCACTTGGTTGGAAAATTAGGAGAAACATTGCTTATGGGGTAGCATGTGGCCTTGAATATCTCCATTGTGACGGTCCAAATATTTGCCATGCTCATCTTGTTAACTCTGAACTTGAAACCAAGATCATTGGTGGCTATTGTGCACCGGAGGTGAAGGATGCCCACGAAGTTTCTCTGGAGGCCGATGTGTACGGATTTGGAATTGTGGTTTTGGAACTACTGACTGGCGAGGAGCCAATAAATAGTGAAGATCGAGGTGGAATTGGTTAA

Network for GWHGAAZE022528

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	55	100	4.40E-06

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-III

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.976
	SRR3591706	second leaf	0.551
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	2.269
	SRR3591709	Stem	5.112
	SRR3591710	White floral bud	2.152
	SRR3591711	White flower	2.564
	SRR3591712	Green floral bud	0.051
	SRR3591713	Yellow flower	1.186
SRP173429	SRR8316895	Juvenile bud stage	0.283
	SRR8316896	Juvenile bud stage	0.121
	SRR8316897	Juvenile bud stage	0.139
	SRR8316894	Third green stage	0.066
	SRR8316900	Third green stage	0.129
	SRR8316901	Third green stage	0.183
	SRR8316898	Complete white stage	0.076
	SRR8316899	Complete white stage	0.825
	SRR8316903	Complete white stage	0.329
	SRR8316902	Silver flowering stage	0.197
	SRR8316904	Silver flowering stage	0.096
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.937
	SRR8316908	Gold flowering stage	0.058
SRP132670	SRR6706286	Control	0.246
	SRR6706287	Light intensity 50%	0.282
	SRR6706288	Light intensity 20%	0.227
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.075
	CNS0095593	Slightly white alabastrum(diploid) 2	1.138
	CNS0095594	Slightly white alabastrum(diploid) 3	0.402
	CNS0095595	Whole white alabastrum(diploid) 2	0.045
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	1.365
	CNS0095599	Silvery flower (diploied) 2	0.714
	CNS0095600	Silvery flower (diploied) 3	0.769
	CNS0095601	Golden flower (diploid) 1	0.594
	CNS0095602	Golden flower (diploid) 2	0.560
	CNS0095603	Golden flower (diploid) 3	0.943
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.169
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.131
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.352
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.515
	CNS0095610	Silvery flower (tetraploid) 1	0.478
	CNS0095611	Silvery flower (tetraploid) 2	0.119
	CNS0095612	Silvery flower (tetraploid) 3	0.521
	CNS0095613	Golden flower (tetraploid) 1	0.137
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.187
	CRR073298	Stem 2	0.177
	CRR073299	Stem 3	0.024
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.154
	CRR073302	Leaf 3	0.461
	CRR073303	Juvenile bud 1	0.461
	CRR073304	Juvenile bud 2	0.086
	CRR073305	Juvenile bud 3	0.662
	CRR073306	Third green 1	0.323
	CRR073307	Third green 2	0.152
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.907
	CRR073311	Second white 3	0.083
	CRR073312	Silver flowering 1	0.076
	CRR073313	Silver flowering 2	0.011
	CRR073314	Silver flowering 3	0.022
	CRR073315	Gold flowering 1	0.620
	CRR073316	Gold flowering 2	0.427
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.117
	CRR073319	Tawny withering 2	2.492
	CRR073320	Tawny withering 3	1.255