Gene detail

Detail information of GWHGAAZE022527

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002317861.2	1.23289E-46	hypothetical protein POPTR_0012s04170g [Populus trichocarpa]
COG	YP_001958461.1	0.0000002	hypothetical protein Aasi_1443
Swissprot	tr\|Q9LVI6\|RLK90_ARATH	5E-45	Probable inactive receptor kinase RLK902 (Precursor)
trEMBL	tr\|B9I2C3\|B9I2C3_POPTR	5E-47	Uncharacterized protein {ECO:0000313\|EMBL:EEE96081.2}
TAIR10	AT1G48480.1	3E-32	receptor-like kinase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	74000748	74002215	+
GWHAAZE00000006	mRNA	74000748	74002215	+
GWHAAZE00000006	exon	74000748	74000882	+
GWHAAZE00000006	exon	74000973	74001090	+
GWHAAZE00000006	exon	74001971	74002215	+
GWHAAZE00000006	CDS	74000748	74000882	+
GWHAAZE00000006	CDS	74000973	74001090	+
GWHAAZE00000006	CDS	74001971	74002215	+

Transcript Sequence
>GWHTAAZE022557 ATGGCAGAGAGCTCAAATGAAAGGACAAAGGGGTTGGTGCTGTTTGGGAACAATTCTGAGGTATTTGAGTTAGAGGAACTGCTGAATTCTTCAGCCGAGATTTTGGGAGAGGGGGCTTTTGGGTATACTTACAAGTTAGGAGGAGTGGTTCATGAAAATTTGCTTCCTCTTAAAGGATATTGCTATTATTCGAATGTGAGGCGACTTTTGTACAATTACATGCTCGTTGGAAGCTTATCTTCTCTTTTGCATGGAAGCCAAGGCATAGACAAGACTTGGCTCAGCTGGGAAGTTAGGTCACACATTGCTTTTGGCATTGCCCGAGCCATTAAACATATCCATTCACTAGGACCCAATATTCACCATGGAAACATAAAGTCATCAAATGTTTTCCTCACAAGTTTCTACGATGCCCATTTGTCAGAATTTGGCTTAACTCAACTCATTTCAACCGAATCCAAAACCAACCTTGCTGCTGGCTATTGCGCACCGAAGTGA

Network for GWHGAAZE022527

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	49	164	6.60E-11

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-III

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005524	molecular_function	ATP binding
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.361
	SRR3591706	second leaf	0.037
	SRR3591707	mature leaf	0.925
	SRR3591708	Shoot apex	0.322
	SRR3591709	Stem	0.031
	SRR3591710	White floral bud	5.608
	SRR3591711	White flower	6.118
	SRR3591712	Green floral bud	0.148
	SRR3591713	Yellow flower	7.513
SRP173429	SRR8316895	Juvenile bud stage	0.235
	SRR8316896	Juvenile bud stage	0.321
	SRR8316897	Juvenile bud stage	0.215
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.083
	SRR8316901	Third green stage	0.092
	SRR8316898	Complete white stage	1.735
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	2.131
	SRR8316902	Silver flowering stage	2.117
	SRR8316904	Silver flowering stage	3.913
	SRR8316905	Silver flowering stage	1.037
	SRR8316906	Gold flowering stage	4.019
	SRR8316907	Gold flowering stage	4.304
	SRR8316908	Gold flowering stage	2.908
SRP132670	SRR6706286	Control	0.080
	SRR6706287	Light intensity 50%	0.106
	SRR6706288	Light intensity 20%	0.273
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.317
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.238
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.564
	CNS0095599	Silvery flower (diploied) 2	0.843
	CNS0095600	Silvery flower (diploied) 3	4.976
	CNS0095601	Golden flower (diploid) 1	0.390
	CNS0095602	Golden flower (diploid) 2	2.952
	CNS0095603	Golden flower (diploid) 3	1.852
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.093
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.532
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.234
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.178
	CNS0095610	Silvery flower (tetraploid) 1	4.282
	CNS0095611	Silvery flower (tetraploid) 2	4.442
	CNS0095612	Silvery flower (tetraploid) 3	21.355
	CNS0095613	Golden flower (tetraploid) 1	7.920
	CNS0095614	Golden flower (tetraploid) 2	3.187
	CNS0095615	Golden flower (tetraploid) 3	5.150
CRA001975	CRR073297	Stem 1	0.132
	CRR073298	Stem 2	0.400
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.109
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.108
	CRR073303	Juvenile bud 1	0.312
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	6.109
	CRR073307	Third green 2	5.663
	CRR073308	Third green 3	5.624
	CRR073309	Second white 1	3.131
	CRR073310	Second white 2	4.545
	CRR073311	Second white 3	5.990
	CRR073312	Silver flowering 1	3.685
	CRR073313	Silver flowering 2	3.359
	CRR073314	Silver flowering 3	4.606
	CRR073315	Gold flowering 1	0.393
	CRR073316	Gold flowering 2	0.817
	CRR073317	Gold flowering 3	0.092
	CRR073318	Tawny withering 1	1.040
	CRR073319	Tawny withering 2	0.218
	CRR073320	Tawny withering 3	0.124