Gene detail

Detail information of GWHGAAZE022379

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007043238.1	5.7777E-103	Isoprenylcysteine carboxyl methyltransferase family [Theobroma cacao]
COG	YP_001526031.1	2E-14	isoprenylcysteine carboxyl methyltransferase
Swissprot	tr\|Q93W54\|ICMTB_ARATH	1E-93	Protein-S-isoprenylcysteine O-methyltransferase B
trEMBL	tr\|A0A061E203\|A0A061E203_THECC	2E-103	Isoprenylcysteine carboxyl methyltransferase family {ECO:0000313\|EMBL:EOX99069.1}
TAIR10	AT5G08335.1	2E-74	Isoprenylcysteine carboxyl methyltransferase (ICMT) family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	71391152	71391697	-
GWHAAZE00000006	mRNA	71391152	71391697	-
GWHAAZE00000006	exon	71391152	71391697	-
GWHAAZE00000006	CDS	71391152	71391697	-

Transcript Sequence
>GWHTAAZE022409 ATGTTGTTCGCTATATTCTTCTTTCATGCTTCTGAATACATTCTAGCACTTGCCATTCATGGATCAAATGTAACACTTAGGTCTCTTTTGATCAGCAAAAATTATCTCCTTGCAATGATTCTTTCACTGGTAGAATACTTGGTTGAAATTTACTTTTTCCCTGGGCTGAAGGAGCACTGGTGGATAAGCAATGTAGGTCTTGCAATGGTAATCGTTGGGGAATTCATTCGAAAATTGGCCATTCTAACAGCTGGTCAAGCCTTCACTCATCTTATTAAAACATATCATGAGGAGCACCACAAATTGGTTACTCATGGCGTGTATAGATTAGTTCGTCATCCAGGATATTGTGGTTTCTTTATCTGGTCAATTGGTACTCAAATAATGCTATGTAATCCAATATCCACGGTCGCATTTGTGTTGGTTGTTTGGCGCTTTTTCTCAGAACGGATACCATATGAAGAGTATTTCTTGAGGCGGTTTTTTGGGTCACAATACGACGATTACGCAGCACGGGTTTCTTCTGGGGTCCCCTTTGTTAAGTGA

Network for GWHGAAZE022379

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04140.15	ICMT	67	158	4.80E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00587	ICMT, STE14	Biosynthesis of secondary metabolites	map01110
K00587	ICMT, STE14	Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0006481	biological_process	C-terminal protein methylation
GO:0016021	cellular_component	integral component of membrane
GO:0005783	cellular_component	endoplasmic reticulum
GO:0004671	molecular_function	protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.617
	SRR3591706	second leaf	3.751
	SRR3591707	mature leaf	3.609
	SRR3591708	Shoot apex	6.565
	SRR3591709	Stem	7.682
	SRR3591710	White floral bud	2.151
	SRR3591711	White flower	1.408
	SRR3591712	Green floral bud	2.933
	SRR3591713	Yellow flower	1.679
SRP173429	SRR8316895	Juvenile bud stage	5.798
	SRR8316896	Juvenile bud stage	5.969
	SRR8316897	Juvenile bud stage	1.002
	SRR8316894	Third green stage	4.119
	SRR8316900	Third green stage	10.694
	SRR8316901	Third green stage	9.732
	SRR8316898	Complete white stage	6.998
	SRR8316899	Complete white stage	17.856
	SRR8316903	Complete white stage	10.604
	SRR8316902	Silver flowering stage	5.994
	SRR8316904	Silver flowering stage	8.945
	SRR8316905	Silver flowering stage	3.460
	SRR8316906	Gold flowering stage	15.280
	SRR8316907	Gold flowering stage	13.785
	SRR8316908	Gold flowering stage	11.443
SRP132670	SRR6706286	Control	3.992
	SRR6706287	Light intensity 50%	4.311
	SRR6706288	Light intensity 20%	4.171
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.892
	CNS0095593	Slightly white alabastrum(diploid) 2	7.714
	CNS0095594	Slightly white alabastrum(diploid) 3	5.808
	CNS0095595	Whole white alabastrum(diploid) 2	5.828
	CNS0095596	Whole white alabastrum(diploid) 3	4.444
	CNS0095597	Whole white alabastrum(diploid) 4	5.696
	CNS0095598	Silvery flower (diploied) 1	11.814
	CNS0095599	Silvery flower (diploied) 2	6.231
	CNS0095600	Silvery flower (diploied) 3	12.061
	CNS0095601	Golden flower (diploid) 1	8.866
	CNS0095602	Golden flower (diploid) 2	15.512
	CNS0095603	Golden flower (diploid) 3	15.996
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.162
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.202
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.076
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.436
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.571
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.511
	CNS0095610	Silvery flower (tetraploid) 1	19.156
	CNS0095611	Silvery flower (tetraploid) 2	22.156
	CNS0095612	Silvery flower (tetraploid) 3	44.965
	CNS0095613	Golden flower (tetraploid) 1	13.494
	CNS0095614	Golden flower (tetraploid) 2	20.914
	CNS0095615	Golden flower (tetraploid) 3	23.285
CRA001975	CRR073297	Stem 1	4.766
	CRR073298	Stem 2	3.688
	CRR073299	Stem 3	6.042
	CRR073300	Leaf 1	5.476
	CRR073301	Leaf 2	4.817
	CRR073302	Leaf 3	4.054
	CRR073303	Juvenile bud 1	5.916
	CRR073304	Juvenile bud 2	7.279
	CRR073305	Juvenile bud 3	5.495
	CRR073306	Third green 1	4.400
	CRR073307	Third green 2	5.514
	CRR073308	Third green 3	6.814
	CRR073309	Second white 1	11.498
	CRR073310	Second white 2	12.937
	CRR073311	Second white 3	11.198
	CRR073312	Silver flowering 1	9.078
	CRR073313	Silver flowering 2	9.813
	CRR073314	Silver flowering 3	6.685
	CRR073315	Gold flowering 1	8.538
	CRR073316	Gold flowering 2	5.924
	CRR073317	Gold flowering 3	6.094
	CRR073318	Tawny withering 1	8.716
	CRR073319	Tawny withering 2	12.474
	CRR073320	Tawny withering 3	8.435