Gene detail

Detail information of GWHGAAZE022227

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011100775.1	8.80714E-32	PREDICTED: ocs element-binding factor 1-like [Sesamum indicum]
Swissprot	tr\|P24068\|OCS1_MAIZE	5E-17	Ocs element-binding factor 1
trEMBL	tr\|A0A061DZX3\|A0A061DZX3_THECC	1E-26	Basic leucine-zipper 44 {ECO:0000313\|EMBL:EOX97947.1}
TAIR10	AT2G18160.1	0.000000005	basic leucine-zipper 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	68941123	68941509	+
GWHAAZE00000006	mRNA	68941123	68941509	+
GWHAAZE00000006	exon	68941123	68941509	+
GWHAAZE00000006	CDS	68941123	68941509	+

Transcript Sequence
>GWHTAAZE022255 ATGGACGAGAAAAAGCGGAAGAGAATGATCTCGAATCGCGAATCGGCGAGGAGATCGAGGATGAGGCGAGAGCAGCACTTGAAGGATCTCCACTCTCAGATCGCGTTCTTCGAGAGCAAAAGGAACGAGATGATTCAAAGGATAAACCAGATCTCGCAGAGTTATGCAATGATCGAGACGGAGAACAGAGTTCTGATGGCTCAGAAGGAAGAGTTGAGCAATAGGCTCGAGTGCGCGGAGATTGTTTCGAGTTATATCAATGGCGGAACCAGCAGCGAGTATAATTTGATGGAGTTTGTCGGTGAGGATCCGTGGATGAAGGCATGGCAGGCTCCATCTCAGTCTCTGCCTATGATAACCACTTCTGCTGGAGTTTTTAATTTCTGA

Network for GWHGAAZE022227

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	4	62	9.50E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	47.911
	SRR3591706	second leaf	46.636
	SRR3591707	mature leaf	36.028
	SRR3591708	Shoot apex	75.986
	SRR3591709	Stem	55.127
	SRR3591710	White floral bud	59.793
	SRR3591711	White flower	49.842
	SRR3591712	Green floral bud	93.180
	SRR3591713	Yellow flower	41.257
SRP173429	SRR8316895	Juvenile bud stage	19.982
	SRR8316896	Juvenile bud stage	37.957
	SRR8316897	Juvenile bud stage	9.699
	SRR8316894	Third green stage	22.840
	SRR8316900	Third green stage	121.978
	SRR8316901	Third green stage	128.854
	SRR8316898	Complete white stage	47.682
	SRR8316899	Complete white stage	160.196
	SRR8316903	Complete white stage	61.487
	SRR8316902	Silver flowering stage	16.959
	SRR8316904	Silver flowering stage	18.869
	SRR8316905	Silver flowering stage	10.241
	SRR8316906	Gold flowering stage	32.734
	SRR8316907	Gold flowering stage	23.332
	SRR8316908	Gold flowering stage	15.889
SRP132670	SRR6706286	Control	173.983
	SRR6706287	Light intensity 50%	156.791
	SRR6706288	Light intensity 20%	152.659
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	52.620
	CNS0095593	Slightly white alabastrum(diploid) 2	99.095
	CNS0095594	Slightly white alabastrum(diploid) 3	39.318
	CNS0095595	Whole white alabastrum(diploid) 2	84.226
	CNS0095596	Whole white alabastrum(diploid) 3	102.819
	CNS0095597	Whole white alabastrum(diploid) 4	75.238
	CNS0095598	Silvery flower (diploied) 1	23.717
	CNS0095599	Silvery flower (diploied) 2	41.889
	CNS0095600	Silvery flower (diploied) 3	51.868
	CNS0095601	Golden flower (diploid) 1	49.651
	CNS0095602	Golden flower (diploid) 2	40.058
	CNS0095603	Golden flower (diploid) 3	43.879
	CNS0095604	Slightly white alabastrum(tetraploid) 1	141.458
	CNS0095605	Slightly white alabastrum(tetraploid) 2	136.453
	CNS0095606	Slightly white alabastrum(tetraploid) 3	239.020
	CNS0095607	Whole white alabastrum(tetraploid) 1	105.404
	CNS0095608	Whole white alabastrum(tetraploid) 2	88.670
	CNS0095609	Whole white alabastrum(tetraploid) 3	115.525
	CNS0095610	Silvery flower (tetraploid) 1	67.193
	CNS0095611	Silvery flower (tetraploid) 2	71.831
	CNS0095612	Silvery flower (tetraploid) 3	23.359
	CNS0095613	Golden flower (tetraploid) 1	85.067
	CNS0095614	Golden flower (tetraploid) 2	60.960
	CNS0095615	Golden flower (tetraploid) 3	40.135
CRA001975	CRR073297	Stem 1	90.840
	CRR073298	Stem 2	98.897
	CRR073299	Stem 3	78.911
	CRR073300	Leaf 1	174.753
	CRR073301	Leaf 2	194.473
	CRR073302	Leaf 3	212.744
	CRR073303	Juvenile bud 1	219.642
	CRR073304	Juvenile bud 2	134.291
	CRR073305	Juvenile bud 3	103.479
	CRR073306	Third green 1	25.704
	CRR073307	Third green 2	37.381
	CRR073308	Third green 3	34.484
	CRR073309	Second white 1	5.882
	CRR073310	Second white 2	8.398
	CRR073311	Second white 3	5.456
	CRR073312	Silver flowering 1	6.198
	CRR073313	Silver flowering 2	4.558
	CRR073314	Silver flowering 3	5.070
	CRR073315	Gold flowering 1	69.291
	CRR073316	Gold flowering 2	68.495
	CRR073317	Gold flowering 3	27.006
	CRR073318	Tawny withering 1	36.484
	CRR073319	Tawny withering 2	25.150
	CRR073320	Tawny withering 3	27.080