Gene detail

Detail information of GWHGAAZE022221

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002874941.1	1.5129E-131	Os01g0254000 [Arabidopsis lyrata subsp. lyrata]
COG	YP_001737337.1	6E-20	small GTP-binding protein
Swissprot	tr\|O04834\|SAR1A_ARATH	2E-132	GTP-binding protein SAR1A
trEMBL	tr\|D7M454\|D7M454_ARALL	6E-132	Os01g0254000 {ECO:0000313\|EMBL:EFH51200.1}
TAIR10	AT4G02080.1	3E-85	secretion-associated RAS super family 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	68840251	68841658	-
GWHAAZE00000006	mRNA	68840251	68841658	-
GWHAAZE00000006	exon	68840251	68840571	-
GWHAAZE00000006	exon	68841110	68841241	-
GWHAAZE00000006	exon	68841530	68841658	-
GWHAAZE00000006	CDS	68841530	68841658	-
GWHAAZE00000006	CDS	68841110	68841241	-
GWHAAZE00000006	CDS	68840251	68840571	-

Transcript Sequence
>GWHTAAZE022249 ATGTTTCTGGTGGATTGGTTTTACGGGATTCTGGCATCTCTCGGTCTCTGGCAAAAGGAGGCCAAGATTTTGTTTTTGGGTCTTGATAATGCCGGCAAGACCACTTTGCTTCATATGTTGAAAGACGAGAGATTGGCGCAGCATCAACCCACACAGCACCCAACATCCGAAGAATTGAGTATTGGAAAAATTAAGTTCAAGGCTTTTGATTTGGGTGGCCATCAAATCGCACGCAGAGTCTGGAAGGACTATTATGCTCAGGTGGATGCAGTAGTGTACCTCGTTGATGCTTATGACAAGGAGAGATTTGCCGAGTCAAGAAAAGAGCTGGATGCCCTCCTATCCGAGGAGTCACTATCAAACGTACCGTTTCTGATACTAGGAAACAAGATAGACATACCCTACGCTTCCTCAGAGGATGAGTTGCGATACTACTTGGGGCTAACTGGAGTCACAACTGGCAAGGGCAGGGTCAACCTTACTGACACTAATGTTCGTCCCATTGAGGTTTTCATGTGCAGCATTGTGCGTAAAATGGGATACGGGGATGGCTTCAAGTGGATGTCCCAATATATCAAGTAG

Network for GWHGAAZE022221

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00025.22	Arf	8	192	1.40E-65

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07953	SAR1	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	20.823
	SRR3591706	second leaf	16.670
	SRR3591707	mature leaf	9.625
	SRR3591708	Shoot apex	24.176
	SRR3591709	Stem	25.142
	SRR3591710	White floral bud	44.919
	SRR3591711	White flower	33.287
	SRR3591712	Green floral bud	46.932
	SRR3591713	Yellow flower	52.419
SRP173429	SRR8316895	Juvenile bud stage	22.834
	SRR8316896	Juvenile bud stage	38.594
	SRR8316897	Juvenile bud stage	10.904
	SRR8316894	Third green stage	14.580
	SRR8316900	Third green stage	40.749
	SRR8316901	Third green stage	37.703
	SRR8316898	Complete white stage	17.065
	SRR8316899	Complete white stage	37.570
	SRR8316903	Complete white stage	30.042
	SRR8316902	Silver flowering stage	18.299
	SRR8316904	Silver flowering stage	22.784
	SRR8316905	Silver flowering stage	13.966
	SRR8316906	Gold flowering stage	39.569
	SRR8316907	Gold flowering stage	32.283
	SRR8316908	Gold flowering stage	20.314
SRP132670	SRR6706286	Control	45.826
	SRR6706287	Light intensity 50%	35.345
	SRR6706288	Light intensity 20%	34.121
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	36.844
	CNS0095593	Slightly white alabastrum(diploid) 2	30.588
	CNS0095594	Slightly white alabastrum(diploid) 3	45.007
	CNS0095595	Whole white alabastrum(diploid) 2	26.690
	CNS0095596	Whole white alabastrum(diploid) 3	30.125
	CNS0095597	Whole white alabastrum(diploid) 4	24.111
	CNS0095598	Silvery flower (diploied) 1	38.404
	CNS0095599	Silvery flower (diploied) 2	35.568
	CNS0095600	Silvery flower (diploied) 3	48.302
	CNS0095601	Golden flower (diploid) 1	49.839
	CNS0095602	Golden flower (diploid) 2	55.305
	CNS0095603	Golden flower (diploid) 3	49.883
	CNS0095604	Slightly white alabastrum(tetraploid) 1	43.240
	CNS0095605	Slightly white alabastrum(tetraploid) 2	41.472
	CNS0095606	Slightly white alabastrum(tetraploid) 3	37.777
	CNS0095607	Whole white alabastrum(tetraploid) 1	45.182
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.529
	CNS0095609	Whole white alabastrum(tetraploid) 3	39.165
	CNS0095610	Silvery flower (tetraploid) 1	46.004
	CNS0095611	Silvery flower (tetraploid) 2	51.094
	CNS0095612	Silvery flower (tetraploid) 3	58.671
	CNS0095613	Golden flower (tetraploid) 1	58.499
	CNS0095614	Golden flower (tetraploid) 2	66.959
	CNS0095615	Golden flower (tetraploid) 3	115.560
CRA001975	CRR073297	Stem 1	39.290
	CRR073298	Stem 2	38.663
	CRR073299	Stem 3	44.479
	CRR073300	Leaf 1	33.505
	CRR073301	Leaf 2	34.075
	CRR073302	Leaf 3	30.290
	CRR073303	Juvenile bud 1	37.706
	CRR073304	Juvenile bud 2	36.766
	CRR073305	Juvenile bud 3	28.871
	CRR073306	Third green 1	30.606
	CRR073307	Third green 2	25.349
	CRR073308	Third green 3	23.203
	CRR073309	Second white 1	34.199
	CRR073310	Second white 2	25.845
	CRR073311	Second white 3	23.999
	CRR073312	Silver flowering 1	20.865
	CRR073313	Silver flowering 2	24.790
	CRR073314	Silver flowering 3	19.370
	CRR073315	Gold flowering 1	17.185
	CRR073316	Gold flowering 2	24.214
	CRR073317	Gold flowering 3	15.267
	CRR073318	Tawny withering 1	28.611
	CRR073319	Tawny withering 2	24.813
	CRR073320	Tawny withering 3	22.289