Gene detail

Detail information of GWHGAAZE022131

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006342835.1	3.26587E-76	PREDICTED: cullin-1-like [Solanum tuberosum]
Swissprot	tr\|Q94AH6\|CUL1_ARATH	5E-56	Cullin-1
trEMBL	tr\|A0A061EP85\|A0A061EP85_THECC	2E-73	Cullin 1, putative {ECO:0000313\|EMBL:EOY06478.1}
TAIR10	AT4G02570.4	2E-38	cullin 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	67331607	67333498	-
GWHAAZE00000006	mRNA	67331607	67333498	-
GWHAAZE00000006	exon	67331607	67331684	-
GWHAAZE00000006	exon	67332164	67332241	-
GWHAAZE00000006	exon	67332333	67332536	-
GWHAAZE00000006	exon	67332726	67332773	-
GWHAAZE00000006	exon	67332888	67333028	-
GWHAAZE00000006	exon	67333412	67333498	-
GWHAAZE00000006	CDS	67333412	67333498	-
GWHAAZE00000006	CDS	67332888	67333028	-
GWHAAZE00000006	CDS	67332726	67332773	-
GWHAAZE00000006	CDS	67332333	67332536	-
GWHAAZE00000006	CDS	67332164	67332241	-
GWHAAZE00000006	CDS	67331607	67331684	-

Transcript Sequence
>GWHTAAZE022159 ATGTGTGTTCCAAATCATTATGGTCCCGTGCCTAGAAAATTGTATGACCTGTATAAGCTTACCATTGAAGATTATACCACTTCCAAGGAAGTGGTGAAAAGATGGAAGAATCACAAAGTTTTGACCAGATGGCTTTCAAGATTCCTCTATTATGTTGAAAGATATTTTATCACCTCCAAAAAACTGCCTACTCTCAAAGCAGCAAGCTACTTGATTTTCCATAATCTGGTTTACGGCGAATTGAATGATCAAGTGAGAGATGGAGTTCTACTTATGATAAATCGGGAGCGCAAAGGAGAACAAATTGATAGAACTCTAGTAAAAGAGATTTTGGATATCTATGTGGAGATGGATGAAGAGTCAATGAAATATTATGAGAGAGATTTTGAAGAAGCCATGCTTCAAAGCACTGCTTCATTCTATTCTGGAATAGCCTTAAACTGGATAACAAGCTATTCTTACGAGGATTACATGCTTAAGGTTGAAGAATGCTTGAAAGAGGAGAAAGAAAAATTTTCTTGTTACTTGAAAGGCAGTAGCCAAAATGAGCTATTAGAGGTTTTACAAGAAGAATTGTTCGCTTTATACGCCTGCAAGGTAGAGGAAAAGAAACAGCTTGATGGCAAAGCTGCATAG

Network for GWHGAAZE022131

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00888.23	Cullin	26	196	1.20E-31

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	Cullin

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process
GO:0031625	molecular_function	ubiquitin protein ligase binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	70.094
	SRR3591706	second leaf	13.268
	SRR3591707	mature leaf	13.502
	SRR3591708	Shoot apex	25.595
	SRR3591709	Stem	75.915
	SRR3591710	White floral bud	18.540
	SRR3591711	White flower	50.119
	SRR3591712	Green floral bud	15.552
	SRR3591713	Yellow flower	35.542
SRP173429	SRR8316895	Juvenile bud stage	34.913
	SRR8316896	Juvenile bud stage	34.836
	SRR8316897	Juvenile bud stage	30.601
	SRR8316894	Third green stage	12.377
	SRR8316900	Third green stage	22.297
	SRR8316901	Third green stage	37.118
	SRR8316898	Complete white stage	9.065
	SRR8316899	Complete white stage	71.005
	SRR8316903	Complete white stage	10.923
	SRR8316902	Silver flowering stage	12.541
	SRR8316904	Silver flowering stage	19.071
	SRR8316905	Silver flowering stage	8.471
	SRR8316906	Gold flowering stage	43.249
	SRR8316907	Gold flowering stage	25.582
	SRR8316908	Gold flowering stage	48.698
SRP132670	SRR6706286	Control	1.082
	SRR6706287	Light intensity 50%	1.263
	SRR6706288	Light intensity 20%	1.261
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	46.866
	CNS0095593	Slightly white alabastrum(diploid) 2	51.964
	CNS0095594	Slightly white alabastrum(diploid) 3	49.914
	CNS0095595	Whole white alabastrum(diploid) 2	26.844
	CNS0095596	Whole white alabastrum(diploid) 3	8.208
	CNS0095597	Whole white alabastrum(diploid) 4	26.913
	CNS0095598	Silvery flower (diploied) 1	70.117
	CNS0095599	Silvery flower (diploied) 2	41.894
	CNS0095600	Silvery flower (diploied) 3	26.609
	CNS0095601	Golden flower (diploid) 1	61.402
	CNS0095602	Golden flower (diploid) 2	32.886
	CNS0095603	Golden flower (diploid) 3	34.655
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.836
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.698
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.917
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.926
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.419
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.843
	CNS0095610	Silvery flower (tetraploid) 1	19.438
	CNS0095611	Silvery flower (tetraploid) 2	8.023
	CNS0095612	Silvery flower (tetraploid) 3	3.945
	CNS0095613	Golden flower (tetraploid) 1	11.586
	CNS0095614	Golden flower (tetraploid) 2	20.428
	CNS0095615	Golden flower (tetraploid) 3	6.895
CRA001975	CRR073297	Stem 1	2.737
	CRR073298	Stem 2	3.174
	CRR073299	Stem 3	1.019
	CRR073300	Leaf 1	6.277
	CRR073301	Leaf 2	7.819
	CRR073302	Leaf 3	3.001
	CRR073303	Juvenile bud 1	1.495
	CRR073304	Juvenile bud 2	0.496
	CRR073305	Juvenile bud 3	1.013
	CRR073306	Third green 1	0.645
	CRR073307	Third green 2	1.248
	CRR073308	Third green 3	1.148
	CRR073309	Second white 1	0.329
	CRR073310	Second white 2	1.082
	CRR073311	Second white 3	1.151
	CRR073312	Silver flowering 1	0.463
	CRR073313	Silver flowering 2	0.560
	CRR073314	Silver flowering 3	2.724
	CRR073315	Gold flowering 1	2.140
	CRR073316	Gold flowering 2	1.864
	CRR073317	Gold flowering 3	0.500
	CRR073318	Tawny withering 1	19.477
	CRR073319	Tawny withering 2	31.047
	CRR073320	Tawny withering 3	15.816