Gene detail

Detail information of GWHGAAZE022058

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADJ67439.1	1.18245E-67	ethylene response factor 10 [Actinidia deliciosa]
Swissprot	tr\|Q8LDC8\|ERF92_ARATH	8E-68	Ethylene-responsive transcription factor 1B
trEMBL	tr\|D8VD37\|D8VD37_ACTDE	4E-68	Ethylene response factor 10 {ECO:0000313\|EMBL:ADJ67439.1}
TAIR10	AT3G23240.1	6E-37	ethylene response factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	66329572	66330111	+
GWHAAZE00000006	mRNA	66329572	66330111	+
GWHAAZE00000006	exon	66329572	66330111	+
GWHAAZE00000006	CDS	66329572	66330111	+

Transcript Sequence
>GWHTAAZE022086 ATGCTCCTGTTTGCTATGCTAGCACAAGCGACCCAAACATGGGAAAGCAATTCCCCTGTTTTAGCAAAGGAAACAGAGGAGGTGAATTCCAAATCCGAGGGAAACCCAAACAAAGGAAAGACCTACAGAGGTGTAAGAAGGCGGCCATGGGGAAAATTTGCAGCGGAAATTAGGGATTCAACTAGGAATGGGGTGAGGGTTTGGTTGGGCACATTTGATACGGCAGAGGCAGCGGCTTTGGCTTATGATCAGGCGGCGTTTTCGATGAGGGGTTCGGCGGCAGTCCTGAATTTCCCAGTGGAAAAGGTGAGGGAATCGCTTTCCGGGGTGGATTATCTTCAGGCCGAGGGGTGTTCGCCGGTTGTAGCACTGAAGAAAAGGCATTCCATGAGGAGGAGAAGTACAAGCAAGAAAAGTAAAGGGAAAAACAGAGAGGTGAAAATAGAGAATGTTGTAGAGTTAGAGGATTTGGGTGCTGATTATTTGGAGGAACTATTGAGTTGTAGTGTGAATAATAATAGTAATTCTAGTGCTTGGTGA

Network for GWHGAAZE022058

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	42	91	4.00E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
K14516	ERF1	MAPK signaling pathway - plant	map04016
K14516	ERF1	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.839
	SRR3591706	second leaf	0.418
	SRR3591707	mature leaf	12.905
	SRR3591708	Shoot apex	1.236
	SRR3591709	Stem	4.144
	SRR3591710	White floral bud	2.845
	SRR3591711	White flower	31.413
	SRR3591712	Green floral bud	0.824
	SRR3591713	Yellow flower	256.018
SRP173429	SRR8316895	Juvenile bud stage	3.708
	SRR8316896	Juvenile bud stage	0.121
	SRR8316897	Juvenile bud stage	2.027
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.141
	SRR8316901	Third green stage	0.230
	SRR8316898	Complete white stage	0.287
	SRR8316899	Complete white stage	1.423
	SRR8316903	Complete white stage	0.505
	SRR8316902	Silver flowering stage	10.853
	SRR8316904	Silver flowering stage	7.650
	SRR8316905	Silver flowering stage	6.435
	SRR8316906	Gold flowering stage	45.148
	SRR8316907	Gold flowering stage	44.842
	SRR8316908	Gold flowering stage	37.388
SRP132670	SRR6706286	Control	0.657
	SRR6706287	Light intensity 50%	0.461
	SRR6706288	Light intensity 20%	0.180
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.163
	CNS0095593	Slightly white alabastrum(diploid) 2	0.164
	CNS0095594	Slightly white alabastrum(diploid) 3	2.537
	CNS0095595	Whole white alabastrum(diploid) 2	0.206
	CNS0095596	Whole white alabastrum(diploid) 3	0.069
	CNS0095597	Whole white alabastrum(diploid) 4	1.282
	CNS0095598	Silvery flower (diploied) 1	33.619
	CNS0095599	Silvery flower (diploied) 2	20.067
	CNS0095600	Silvery flower (diploied) 3	16.646
	CNS0095601	Golden flower (diploid) 1	98.156
	CNS0095602	Golden flower (diploid) 2	89.878
	CNS0095603	Golden flower (diploid) 3	90.728
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.594
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.107
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.101
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.198
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.144
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.196
	CNS0095610	Silvery flower (tetraploid) 1	80.517
	CNS0095611	Silvery flower (tetraploid) 2	31.688
	CNS0095612	Silvery flower (tetraploid) 3	8.132
	CNS0095613	Golden flower (tetraploid) 1	106.065
	CNS0095614	Golden flower (tetraploid) 2	104.151
	CNS0095615	Golden flower (tetraploid) 3	26.870
CRA001975	CRR073297	Stem 1	0.367
	CRR073298	Stem 2	0.294
	CRR073299	Stem 3	0.249
	CRR073300	Leaf 1	0.224
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.224
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.523
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.826
	CRR073307	Third green 2	0.155
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.626
	CRR073311	Second white 3	0.194
	CRR073312	Silver flowering 1	4.075
	CRR073313	Silver flowering 2	4.967
	CRR073314	Silver flowering 3	7.568
	CRR073315	Gold flowering 1	0.388
	CRR073316	Gold flowering 2	2.051
	CRR073317	Gold flowering 3	1.636
	CRR073318	Tawny withering 1	2.147
	CRR073319	Tawny withering 2	6.270
	CRR073320	Tawny withering 3	3.423