Gene detail

Detail information of GWHGAAZE022056

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011029835.1	4.9004E-41	PREDICTED: ethylene-responsive transcription factor ERF098-like [Populus euphratica]
Swissprot	tr\|Q9LTC5\|ERF98_ARATH	4E-41	Ethylene-responsive transcription factor ERF098
trEMBL	tr\|U5G5Z8\|U5G5Z8_POPTR	5E-40	Uncharacterized protein {ECO:0000313\|EMBL:ERP57691.1}
TAIR10	AT3G23230.1	4E-25	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	66289742	66290110	+
GWHAAZE00000006	mRNA	66289742	66290110	+
GWHAAZE00000006	exon	66289742	66290110	+
GWHAAZE00000006	CDS	66289742	66290110	+

Transcript Sequence
>GWHTAAZE022084 ATGGAACCAAACACGGGAAAAACCAAAAATGAGGGAAATGCAGCGGAGGTGAAGTACCGAGGAGTCCGGCGCCGGCCTTGGGGGAAATTTGCTGCGGAGATTCGCGATCCGGCTAGACAAGGTGCGCGCGTGTGGCTTGGCACATTTAATACTGCAGAGGAGGCTGCTAGGGCCTACGACAGAGCTGCCTATTCCATGAGGGATCAATACGCGATACTCAATTTTCCAGGGGAGCATCCTAAGACCTTGTGCTCCGCTTCCTCATCTTCAAGGAACACGAGAAATGAGGGAGGAAAGCAAGTCTTTGAATTCGAGTATTTGGATGATAAGGTGCTGGAAGAACTTCTTGATTACGAGGAGGAAAAATAA

Network for GWHGAAZE022056

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	18	67	1.50E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.256
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	1.418
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	4.384
	SRR3591710	White floral bud	8.520
	SRR3591711	White flower	20.744
	SRR3591712	Green floral bud	1.871
	SRR3591713	Yellow flower	2.367
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.462
	SRR8316898	Complete white stage	0.770
	SRR8316899	Complete white stage	0.394
	SRR8316903	Complete white stage	3.201
	SRR8316902	Silver flowering stage	9.188
	SRR8316904	Silver flowering stage	8.269
	SRR8316905	Silver flowering stage	6.335
	SRR8316906	Gold flowering stage	25.703
	SRR8316907	Gold flowering stage	22.097
	SRR8316908	Gold flowering stage	45.701
SRP132670	SRR6706286	Control	0.648
	SRR6706287	Light intensity 50%	0.660
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.565
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.195
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	7.572
	CNS0095599	Silvery flower (diploied) 2	11.627
	CNS0095600	Silvery flower (diploied) 3	5.860
	CNS0095601	Golden flower (diploid) 1	5.137
	CNS0095602	Golden flower (diploid) 2	6.105
	CNS0095603	Golden flower (diploid) 3	5.366
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.134
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	9.847
	CNS0095611	Silvery flower (tetraploid) 2	0.804
	CNS0095612	Silvery flower (tetraploid) 3	5.592
	CNS0095613	Golden flower (tetraploid) 1	12.959
	CNS0095614	Golden flower (tetraploid) 2	6.456
	CNS0095615	Golden flower (tetraploid) 3	2.634
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.107
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.171
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	2.586
	CRR073307	Third green 2	9.236
	CRR073308	Third green 3	5.088
	CRR073309	Second white 1	2.032
	CRR073310	Second white 2	4.029
	CRR073311	Second white 3	0.353
	CRR073312	Silver flowering 1	0.738
	CRR073313	Silver flowering 2	0.496
	CRR073314	Silver flowering 3	1.390
	CRR073315	Gold flowering 1	8.029
	CRR073316	Gold flowering 2	10.551
	CRR073317	Gold flowering 3	6.046
	CRR073318	Tawny withering 1	7.079
	CRR073319	Tawny withering 2	12.908
	CRR073320	Tawny withering 3	1.856