Gene detail

Detail information of GWHGAAZE022026

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011090782.1	1.10168E-59	PREDICTED: nuclear transcription factor Y subunit C-3-like isoform X2 [Sesamum indicum]
Swissprot	tr\|Q8L4B2\|NFYC9_ARATH	2E-47	Nuclear transcription factor Y subunit C-9
trEMBL	tr\|Q2VY17\|Q2VY17_SOLLC	7E-59	CONSTANS interacting protein 2b {ECO:0000313\|EMBL:AAS67370.1}
TAIR10	AT1G08970.4	6E-39	nuclear factor Y, subunit C9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	65838319	65838714	+
GWHAAZE00000006	mRNA	65838319	65838714	+
GWHAAZE00000006	exon	65838319	65838714	+
GWHAAZE00000006	CDS	65838319	65838714	+

Transcript Sequence
>GWHTAAZE022054 ATGAAAGCCGATGAGGACATAAGGATGATATCTGCTGAAGCTCCAGTCATATTTGCTCAGGCCTGTGAGATGTTTATCCTTGAGTTGACTTTACGGGCTTGGAATCACACCAAAGAGAACAAAAGGAAGACCCTTCAAAGGAATGACATCTCTGCAGCCATCATGATGACCGATGTATTTGATTTCTTGATTGATATTGTACCTAAGGAGGATATGGGAGAGAATGTACTTGCTCCATCGATCCCGCAGGGGGCTTTTACTTTCGGAGGTCCAACTAAGGGAAATCCTTACTATTATTTGCCACAACTGCCAGTGGGACCTCCAGGGATGTTTGTGGGTAAGCCTTTGGACCAAGGGTTTTATGCCCAGCAGCAGAATCATCCTTACATTGCTTAG

Network for GWHGAAZE022026

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	1	54	6.20E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YC

KEGG pathway

KO	Enzyme	pathway	mapID
K08066	NFYC, HAP5	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.228
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.239
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.037
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.416
	SRR8316896	Juvenile bud stage	1.925
	SRR8316897	Juvenile bud stage	0.057
	SRR8316894	Third green stage	0.920
	SRR8316900	Third green stage	1.187
	SRR8316901	Third green stage	1.216
	SRR8316898	Complete white stage	0.518
	SRR8316899	Complete white stage	2.063
	SRR8316903	Complete white stage	1.201
	SRR8316902	Silver flowering stage	0.928
	SRR8316904	Silver flowering stage	1.307
	SRR8316905	Silver flowering stage	0.679
	SRR8316906	Gold flowering stage	2.344
	SRR8316907	Gold flowering stage	3.857
	SRR8316908	Gold flowering stage	1.182
SRP132670	SRR6706286	Control	0.693
	SRR6706287	Light intensity 50%	1.574
	SRR6706288	Light intensity 20%	1.111
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.153
	CNS0095593	Slightly white alabastrum(diploid) 2	1.314
	CNS0095594	Slightly white alabastrum(diploid) 3	3.214
	CNS0095595	Whole white alabastrum(diploid) 2	1.997
	CNS0095596	Whole white alabastrum(diploid) 3	0.672
	CNS0095597	Whole white alabastrum(diploid) 4	1.562
	CNS0095598	Silvery flower (diploied) 1	3.738
	CNS0095599	Silvery flower (diploied) 2	0.468
	CNS0095600	Silvery flower (diploied) 3	1.680
	CNS0095601	Golden flower (diploid) 1	1.786
	CNS0095602	Golden flower (diploid) 2	1.958
	CNS0095603	Golden flower (diploid) 3	1.282
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.403
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.061
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.018
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.080
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.145
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.092
	CNS0095614	Golden flower (tetraploid) 2	0.196
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.464
	CRR073298	Stem 2	1.584
	CRR073299	Stem 3	0.387
	CRR073300	Leaf 1	1.846
	CRR073301	Leaf 2	1.234
	CRR073302	Leaf 3	0.074
	CRR073303	Juvenile bud 1	0.503
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.554
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.260
	CRR073308	Third green 3	0.071
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.609
	CRR073311	Second white 3	0.216
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.387
	CRR073318	Tawny withering 1	0.767
	CRR073319	Tawny withering 2	0.900
	CRR073320	Tawny withering 3	0.567