Gene detail

Detail information of GWHGAAZE021817

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN72597.1	6.4367E-127	hypothetical protein VITISV_015543 [Vitis vinifera]
COG	YP_429772.1	8E-28	serine/threonine protein kinase
Swissprot	tr\|Q9SPK4\|PPCK1_ARATH	7E-79	Phosphoenolpyruvate carboxylase kinase 1
trEMBL	tr\|A5BQJ2\|A5BQJ2_VITVI	2E-127	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN72597.1}
TAIR10	AT1G08650.1	3E-64	phosphoenolpyruvate carboxylase kinase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	61961888	61963030	-
GWHAAZE00000006	mRNA	61961888	61963030	-
GWHAAZE00000006	exon	61962433	61963030	-
GWHAAZE00000006	exon	61961888	61961919	-
GWHAAZE00000006	CDS	61962433	61963030	-
GWHAAZE00000006	CDS	61961888	61961919	-

Transcript Sequence
>GWHTAAZE021841 ATGAACCTAATTTCACCAAACCCTAACATACTCCAAATCTTCAATATTTACGAGGATGATACACATCTCCACATTGTTCTTGAGCTCTGCAACTCCTCCGATCTCTATAGCAGAATCTCAAACCGAGTTTTCTCCGAATCCGAAGCGGTTGTGGTGATGGCGCCGCTGATGGAGGCGATCGCTCACTGTCACCGCAATGGAGTTGCCCATCGAGACTTAAAACCGGACAACGTTTTATTTGACGAGTGGAATCGGCTGAAACTCGCTGATTTTGGATCGGCGGAGTGTTTTAGGGAGGGAGAGTTGATGAGCGGTGTGGTCGGTACGCCGTATTACGTGGCGCCGGAGGTTTTGGCCGGGAGAGAGTATAGTGAGAAGGTGGATGTGTGGAGTGCGGGAGTGATTTTGTATATAATGCTCGCCGGAATCGCTCCGTTTTATGGAGATACGGCGACGGAGATCTTCGAGGCTGTGCTCCGAGCGAATCTAAGGTTTCCGGCTAGGATTTTCAACTCGGTGTCGCCGGCGGCGAAGGATCTTTTGCGGAGGATGCTGTGTAAAGATGTTTCTAGAAGATTCAGCGCCGAGCAAGTTCTCGCGCATCCATGGATGACTGGCGGTGGTGGATAG

Network for GWHGAAZE021817

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	7	204	7.40E-59

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CAMK_CDPK

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.961
	SRR3591706	second leaf	0.480
	SRR3591707	mature leaf	0.276
	SRR3591708	Shoot apex	4.428
	SRR3591709	Stem	19.174
	SRR3591710	White floral bud	8.931
	SRR3591711	White flower	9.542
	SRR3591712	Green floral bud	11.649
	SRR3591713	Yellow flower	0.813
SRP173429	SRR8316895	Juvenile bud stage	13.003
	SRR8316896	Juvenile bud stage	15.799
	SRR8316897	Juvenile bud stage	6.687
	SRR8316894	Third green stage	14.851
	SRR8316900	Third green stage	24.958
	SRR8316901	Third green stage	20.589
	SRR8316898	Complete white stage	1.381
	SRR8316899	Complete white stage	25.723
	SRR8316903	Complete white stage	5.558
	SRR8316902	Silver flowering stage	1.119
	SRR8316904	Silver flowering stage	0.603
	SRR8316905	Silver flowering stage	1.107
	SRR8316906	Gold flowering stage	0.883
	SRR8316907	Gold flowering stage	1.011
	SRR8316908	Gold flowering stage	1.047
SRP132670	SRR6706286	Control	22.227
	SRR6706287	Light intensity 50%	19.291
	SRR6706288	Light intensity 20%	19.025
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.266
	CNS0095593	Slightly white alabastrum(diploid) 2	15.719
	CNS0095594	Slightly white alabastrum(diploid) 3	10.064
	CNS0095595	Whole white alabastrum(diploid) 2	10.598
	CNS0095596	Whole white alabastrum(diploid) 3	13.862
	CNS0095597	Whole white alabastrum(diploid) 4	10.348
	CNS0095598	Silvery flower (diploied) 1	45.647
	CNS0095599	Silvery flower (diploied) 2	21.318
	CNS0095600	Silvery flower (diploied) 3	8.847
	CNS0095601	Golden flower (diploid) 1	36.422
	CNS0095602	Golden flower (diploid) 2	24.541
	CNS0095603	Golden flower (diploid) 3	19.711
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.298
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.655
	CNS0095606	Slightly white alabastrum(tetraploid) 3	20.608
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.318
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.620
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.534
	CNS0095610	Silvery flower (tetraploid) 1	1.401
	CNS0095611	Silvery flower (tetraploid) 2	10.693
	CNS0095612	Silvery flower (tetraploid) 3	16.754
	CNS0095613	Golden flower (tetraploid) 1	0.367
	CNS0095614	Golden flower (tetraploid) 2	1.345
	CNS0095615	Golden flower (tetraploid) 3	1.969
CRA001975	CRR073297	Stem 1	37.935
	CRR073298	Stem 2	34.364
	CRR073299	Stem 3	46.432
	CRR073300	Leaf 1	16.355
	CRR073301	Leaf 2	21.551
	CRR073302	Leaf 3	26.240
	CRR073303	Juvenile bud 1	21.619
	CRR073304	Juvenile bud 2	4.028
	CRR073305	Juvenile bud 3	32.698
	CRR073306	Third green 1	1.215
	CRR073307	Third green 2	1.832
	CRR073308	Third green 3	2.148
	CRR073309	Second white 1	10.562
	CRR073310	Second white 2	4.769
	CRR073311	Second white 3	3.305
	CRR073312	Silver flowering 1	1.623
	CRR073313	Silver flowering 2	2.414
	CRR073314	Silver flowering 3	1.545
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.224
	CRR073317	Gold flowering 3	0.569
	CRR073318	Tawny withering 1	4.721
	CRR073319	Tawny withering 2	2.973
	CRR073320	Tawny withering 3	12.065