Gene detail

Detail information of GWHGAAZE021671

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007154456.1	6.94358E-46	hypothetical protein PHAVU_003G120800g [Phaseolus vulgaris]
Swissprot	tr\|O49339\|PTI12_ARATH	1E-39	PTI1-like tyrosine-protein kinase 2
trEMBL	tr\|V7CB02\|V7CB02_PHAVU	3E-46	Uncharacterized protein {ECO:0000313\|EMBL:ESW26450.1}
TAIR10	AT3G62220.1	5E-34	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	59319665	59320536	-
GWHAAZE00000006	mRNA	59319665	59320536	-
GWHAAZE00000006	exon	59320150	59320536	-
GWHAAZE00000006	exon	59319993	59320079	-
GWHAAZE00000006	exon	59319665	59319814	-
GWHAAZE00000006	CDS	59320150	59320536	-
GWHAAZE00000006	CDS	59319993	59320079	-
GWHAAZE00000006	CDS	59319665	59319814	-

Transcript Sequence
>GWHTAAZE021695 ATGCTTTATTGTCAAAAACTTCAATTACCATCTTCTTGTGAAGTTGACGCGTTAAAATATTCACACTGGTTATGGCAACGGTGGATCAGGTGGGCCCGAGACCTGCATAATTTTGAATTTGATGTTAGAGACTTTGGCATCCCCATTGGCAGTCTGCCGTTGCGTACTAGACGGTATGCAAATACTGGAAAAATTGGTCCTCCAACACGTGTTAGCTGGTATTCAAGTACTGGAAAAATGAGTTTAGAGGGTGACGTTTACAGCTTTGGCGTGGTCCTCTTGGAACTATTGACCGGCCGTAATCCTTTGGATTTTACAAGGCCACATGGAGAACAGAGTCTGGTTAAATGGGTAATCAATTCTTCCACCCTCTCTTTGACTCATAAAGCAACTCCAAAACTCAGCGAAGATAAAGTGAAGCAGTGTATTGACCCTAAATTAAAAGGAGAATTCCATCCCAAACAAGCTGCAAAGATGGCTGCCGTTGCAGCCTTGTGTTTGCAATATGAAGCTGAATACCGTCCGACCATGAGCATTGTAGTTAAAGCCCTCCAGCCTCTGCTGAATACTTTACAAGGACCTAGTCGCAAGGCACCACCCTTGTCAACCACGCACCCTCATTAA

Network for GWHGAAZE021671

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	76	184	3.60E-07

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIII

KEGG pathway

KO	Enzyme	pathway	mapID
K13436	PTI1	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.847
	SRR3591706	second leaf	0.223
	SRR3591707	mature leaf	0.967
	SRR3591708	Shoot apex	2.199
	SRR3591709	Stem	1.198
	SRR3591710	White floral bud	1.670
	SRR3591711	White flower	2.306
	SRR3591712	Green floral bud	2.718
	SRR3591713	Yellow flower	2.478
SRP173429	SRR8316895	Juvenile bud stage	2.502
	SRR8316896	Juvenile bud stage	3.962
	SRR8316897	Juvenile bud stage	0.548
	SRR8316894	Third green stage	0.862
	SRR8316900	Third green stage	1.583
	SRR8316901	Third green stage	3.859
	SRR8316898	Complete white stage	0.397
	SRR8316899	Complete white stage	2.048
	SRR8316903	Complete white stage	1.611
	SRR8316902	Silver flowering stage	1.592
	SRR8316904	Silver flowering stage	1.427
	SRR8316905	Silver flowering stage	0.760
	SRR8316906	Gold flowering stage	2.937
	SRR8316907	Gold flowering stage	3.245
	SRR8316908	Gold flowering stage	1.304
SRP132670	SRR6706286	Control	1.281
	SRR6706287	Light intensity 50%	1.728
	SRR6706288	Light intensity 20%	1.540
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.823
	CNS0095593	Slightly white alabastrum(diploid) 2	3.652
	CNS0095594	Slightly white alabastrum(diploid) 3	4.617
	CNS0095595	Whole white alabastrum(diploid) 2	1.764
	CNS0095596	Whole white alabastrum(diploid) 3	3.546
	CNS0095597	Whole white alabastrum(diploid) 4	2.487
	CNS0095598	Silvery flower (diploied) 1	3.882
	CNS0095599	Silvery flower (diploied) 2	2.732
	CNS0095600	Silvery flower (diploied) 3	2.315
	CNS0095601	Golden flower (diploid) 1	6.284
	CNS0095602	Golden flower (diploid) 2	2.553
	CNS0095603	Golden flower (diploid) 3	2.396
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.486
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.517
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.939
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.876
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.519
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.642
	CNS0095610	Silvery flower (tetraploid) 1	2.516
	CNS0095611	Silvery flower (tetraploid) 2	2.579
	CNS0095612	Silvery flower (tetraploid) 3	2.177
	CNS0095613	Golden flower (tetraploid) 1	1.806
	CNS0095614	Golden flower (tetraploid) 2	2.741
	CNS0095615	Golden flower (tetraploid) 3	0.971
CRA001975	CRR073297	Stem 1	3.386
	CRR073298	Stem 2	1.932
	CRR073299	Stem 3	0.532
	CRR073300	Leaf 1	1.816
	CRR073301	Leaf 2	3.131
	CRR073302	Leaf 3	1.318
	CRR073303	Juvenile bud 1	0.571
	CRR073304	Juvenile bud 2	0.120
	CRR073305	Juvenile bud 3	1.122
	CRR073306	Third green 1	0.562
	CRR073307	Third green 2	0.475
	CRR073308	Third green 3	0.093
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.131
	CRR073311	Second white 3	0.035
	CRR073312	Silver flowering 1	0.303
	CRR073313	Silver flowering 2	0.171
	CRR073314	Silver flowering 3	0.243
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.168
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.861
	CRR073319	Tawny withering 2	2.031
	CRR073320	Tawny withering 3	0.237