Gene detail

Detail information of GWHGAAZE021630

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU44215.1	2.85617E-36	hypothetical protein MIMGU_mgv1a000477mg [Erythranthe guttata]
COG	YP_008737799.1	0.0000007	serine/threonine protein kinase
Swissprot	tr\|O22187\|Y2232_ARATH	2E-31	Probable receptor-like protein kinase At2g23200 (Precursor)
trEMBL	tr\|A0A022RZ14\|A0A022RZ14_ERYGU	1E-36	Uncharacterized protein {ECO:0000313\|EMBL:EYU44215.1}
TAIR10	AT2G23200.1	4E-28	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	58538480	58538929	+
GWHAAZE00000006	mRNA	58538480	58538929	+
GWHAAZE00000006	exon	58538480	58538929	+
GWHAAZE00000006	CDS	58538480	58538929	+

Transcript Sequence
>GWHTAAZE021654 ATGCACATCAGAGGCACATTTGGTTATATGGATCCAGATTATTTCTTGACTCGAAGATACACGAGGGAATCGGATGTGTACGCATTTGGGGTGGTATTGTTGGAAGTACTCTGCGAGAGGCCGGCTCTGGATCGAAGTCTGGATGAGGACCAATGGGGTCTTGCTGGATGGGGCCAGCAGTGCATCAAAGAAGGAGCATCACATCAGATTATTGGGCCAAATTTGAAGTGGGAAATCTTGCCAAATTCTCTCACAGAATTTGTGCAAATTGCCGATCAATGCTTGCATAGTTGTCCAAAGCAACATCCTACAATGTCTGAGGTGGTGGCCAGACTTGAGCATGTGTTGGCATTGCAACTACGCACCAATTTTGTGATCAATGAGTATTTGTTTGATACTTGCTTGCCTGTTACTGACCAAGAAAATGCAGATTCTTATCCAGAGTATTGA

Network for GWHGAAZE021630

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	2	110	1.70E-09

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.147
	SRR3591706	second leaf	1.857
	SRR3591707	mature leaf	2.341
	SRR3591708	Shoot apex	4.036
	SRR3591709	Stem	7.365
	SRR3591710	White floral bud	4.350
	SRR3591711	White flower	4.098
	SRR3591712	Green floral bud	4.471
	SRR3591713	Yellow flower	2.100
SRP173429	SRR8316895	Juvenile bud stage	3.746
	SRR8316896	Juvenile bud stage	4.102
	SRR8316897	Juvenile bud stage	0.569
	SRR8316894	Third green stage	1.763
	SRR8316900	Third green stage	3.665
	SRR8316901	Third green stage	3.856
	SRR8316898	Complete white stage	1.787
	SRR8316899	Complete white stage	5.023
	SRR8316903	Complete white stage	3.877
	SRR8316902	Silver flowering stage	1.789
	SRR8316904	Silver flowering stage	2.564
	SRR8316905	Silver flowering stage	1.158
	SRR8316906	Gold flowering stage	3.521
	SRR8316907	Gold flowering stage	3.068
	SRR8316908	Gold flowering stage	3.836
SRP132670	SRR6706286	Control	4.653
	SRR6706287	Light intensity 50%	5.146
	SRR6706288	Light intensity 20%	5.782
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.510
	CNS0095593	Slightly white alabastrum(diploid) 2	2.939
	CNS0095594	Slightly white alabastrum(diploid) 3	1.455
	CNS0095595	Whole white alabastrum(diploid) 2	1.995
	CNS0095596	Whole white alabastrum(diploid) 3	1.129
	CNS0095597	Whole white alabastrum(diploid) 4	3.488
	CNS0095598	Silvery flower (diploied) 1	4.376
	CNS0095599	Silvery flower (diploied) 2	2.917
	CNS0095600	Silvery flower (diploied) 3	3.717
	CNS0095601	Golden flower (diploid) 1	3.254
	CNS0095602	Golden flower (diploid) 2	4.986
	CNS0095603	Golden flower (diploid) 3	3.701
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.022
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.464
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.787
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.647
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.453
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.882
	CNS0095610	Silvery flower (tetraploid) 1	4.950
	CNS0095611	Silvery flower (tetraploid) 2	3.089
	CNS0095612	Silvery flower (tetraploid) 3	5.446
	CNS0095613	Golden flower (tetraploid) 1	0.861
	CNS0095614	Golden flower (tetraploid) 2	3.755
	CNS0095615	Golden flower (tetraploid) 3	1.300
CRA001975	CRR073297	Stem 1	5.682
	CRR073298	Stem 2	8.229
	CRR073299	Stem 3	3.945
	CRR073300	Leaf 1	5.962
	CRR073301	Leaf 2	5.919
	CRR073302	Leaf 3	3.312
	CRR073303	Juvenile bud 1	2.416
	CRR073304	Juvenile bud 2	1.181
	CRR073305	Juvenile bud 3	1.802
	CRR073306	Third green 1	0.917
	CRR073307	Third green 2	1.185
	CRR073308	Third green 3	1.233
	CRR073309	Second white 1	0.016
	CRR073310	Second white 2	1.408
	CRR073311	Second white 3	0.331
	CRR073312	Silver flowering 1	0.777
	CRR073313	Silver flowering 2	0.112
	CRR073314	Silver flowering 3	0.176
	CRR073315	Gold flowering 1	0.847
	CRR073316	Gold flowering 2	3.704
	CRR073317	Gold flowering 3	0.352
	CRR073318	Tawny withering 1	3.426
	CRR073319	Tawny withering 2	2.075
	CRR073320	Tawny withering 3	2.274