Gene detail

Detail information of GWHGAAZE021621

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KGN53791.1	2.7938E-49	hypothetical protein Csa_4G129570 [Cucumis sativus]
Swissprot	tr\|Q9FID8\|Y5900_ARATH	1E-39	Putative receptor-like protein kinase At5g39000 (Precursor)
trEMBL	tr\|A0A0A0L0X4\|A0A0A0L0X4_CUCSA	1E-49	Uncharacterized protein {ECO:0000313\|EMBL:KGN53791.1}
TAIR10	AT5G39000.1	2E-35	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	58258891	58259745	+
GWHAAZE00000006	mRNA	58258891	58259745	+
GWHAAZE00000006	exon	58258891	58259237	+
GWHAAZE00000006	exon	58259562	58259745	+
GWHAAZE00000006	CDS	58258891	58259237	+
GWHAAZE00000006	CDS	58259562	58259745	+

Transcript Sequence
>GWHTAAZE021645 ATGTTCAGTCCCCCGTCCGAGCAGTTATGCCGTCGCTTTATGCTCCATGAGGTTATATCGGCGACCAACAATTTCGACGATTCCATGGTTATAGGTAAGGGAGGATTCGGTACGGTTTACAAAGGGGATATCATTGATAATAATGGTAATGGCGCATATACTACTGTTGCTTTCAAGCGTTTGAATCCCTTGTCCAAGCAAGGTGCTCCTGAGTTTTGGACCGAGATTAATATGCTATCAAATTTTCGACATAGCCACCTCGTTTCTTTGATCGGCTATTGCGATCATGATAACGAGATGATTCTTGTTTATGAGTATATGGTCCGTGGAACCCTAGCTGACCATTTATTCACGAGGAAATCAGATGTGTACGCATTTGGGGTGGTATTATTGGAAGTACTCTGTGAGAGGCCGGCTGTGGATCGAAGCCTTGATGAGGACCAATGGGGTCTTGCTGGATGGGGCCAGCAGTGCATCAAAGAAGGAGCATCACATCAGATTATTGGGCCGAATTTGAAGTGGGAAATCTAG

Network for GWHGAAZE021621

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	30	116	9.30E-16

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005524	molecular_function	ATP binding
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.363
	SRR3591706	second leaf	0.187
	SRR3591707	mature leaf	0.157
	SRR3591708	Shoot apex	0.992
	SRR3591709	Stem	0.236
	SRR3591710	White floral bud	0.282
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.166
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.033
	SRR8316896	Juvenile bud stage	2.524
	SRR8316897	Juvenile bud stage	0.738
	SRR8316894	Third green stage	1.119
	SRR8316900	Third green stage	3.474
	SRR8316901	Third green stage	2.494
	SRR8316898	Complete white stage	1.253
	SRR8316899	Complete white stage	4.590
	SRR8316903	Complete white stage	2.431
	SRR8316902	Silver flowering stage	0.475
	SRR8316904	Silver flowering stage	1.448
	SRR8316905	Silver flowering stage	0.658
	SRR8316906	Gold flowering stage	1.544
	SRR8316907	Gold flowering stage	2.083
	SRR8316908	Gold flowering stage	1.828
SRP132670	SRR6706286	Control	3.709
	SRR6706287	Light intensity 50%	4.151
	SRR6706288	Light intensity 20%	4.708
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.483
	CNS0095593	Slightly white alabastrum(diploid) 2	1.104
	CNS0095594	Slightly white alabastrum(diploid) 3	0.816
	CNS0095595	Whole white alabastrum(diploid) 2	1.304
	CNS0095596	Whole white alabastrum(diploid) 3	0.431
	CNS0095597	Whole white alabastrum(diploid) 4	1.430
	CNS0095598	Silvery flower (diploied) 1	3.409
	CNS0095599	Silvery flower (diploied) 2	2.643
	CNS0095600	Silvery flower (diploied) 3	3.322
	CNS0095601	Golden flower (diploid) 1	1.374
	CNS0095602	Golden flower (diploid) 2	4.015
	CNS0095603	Golden flower (diploid) 3	3.570
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.476
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.443
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.201
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.956
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.340
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.014
	CNS0095610	Silvery flower (tetraploid) 1	2.512
	CNS0095611	Silvery flower (tetraploid) 2	3.086
	CNS0095612	Silvery flower (tetraploid) 3	1.797
	CNS0095613	Golden flower (tetraploid) 1	0.758
	CNS0095614	Golden flower (tetraploid) 2	2.325
	CNS0095615	Golden flower (tetraploid) 3	1.145
CRA001975	CRR073297	Stem 1	3.503
	CRR073298	Stem 2	2.276
	CRR073299	Stem 3	1.202
	CRR073300	Leaf 1	2.331
	CRR073301	Leaf 2	2.477
	CRR073302	Leaf 3	0.766
	CRR073303	Juvenile bud 1	0.811
	CRR073304	Juvenile bud 2	0.193
	CRR073305	Juvenile bud 3	1.737
	CRR073306	Third green 1	0.637
	CRR073307	Third green 2	0.497
	CRR073308	Third green 3	0.636
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.307
	CRR073311	Second white 3	0.187
	CRR073312	Silver flowering 1	0.186
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.156
	CRR073315	Gold flowering 1	0.076
	CRR073316	Gold flowering 2	0.770
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.856
	CRR073319	Tawny withering 2	0.514
	CRR073320	Tawny withering 3	0.480