Gene detail

Detail information of GWHGAAZE021598

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP02334.1	1.53583E-76	unnamed protein product [Coffea canephora]
COG	YP_005583842.1	2E-19	putative serine/threonine protein kinase
Swissprot	tr\|Q9FID9\|Y5389_ARATH	5E-71	Probable receptor-like protein kinase At5g38990 (Precursor)
trEMBL	tr\|A0A068U2D1\|A0A068U2D1_COFCA	6E-77	Coffea canephora DH200=94 genomic scaffold, scaffold_8 {ECO:0000313\|EMBL:CDP02334.1}
TAIR10	AT5G38990.1	8E-62	Malectin/receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	57682545	57683093	-
GWHAAZE00000006	mRNA	57682545	57683093	-
GWHAAZE00000006	exon	57682545	57683093	-
GWHAAZE00000006	CDS	57682545	57683093	-

Transcript Sequence
>GWHTAAZE021622 ATGCTATCAAAATTTCGACACTGTCATCTTGTATCTTTGATCGGTTACTGTGATGACTCTAATGAGATGATTCTTGTTTACGAATATATGATTCGTGGAACACTTGCTGATCATCTGCACAAAAAAGTCGGTGGAGATGGTAATTCTCCTCTATCCTGGGTGCGACGCCTCAAGATCTGCATAGGGGCTGCACGTGGGCTAGACTACCTACATACTGGTACAGGGGTCTTACACACAGTCATACACCGAGATGTGAAGAGTTCTAACATATTGATCGATGAAAATTGGGCAGCTAAGATTTCGGATTTTGGTTTGTCCAAAATAGGCTCAACAAATCAGGGATTGACCGATGTCAGCACCAAGGTTAAGGGCACGTTTGGGTATCTCGATCCTGAGTATCTCTTGACCCTTAGATTGACGAGGAAATCAGATGTGTACTCGTTTGGGGTTGTATTGATGGAAGTATTGTGTGGGAGGCCAGCACTTGATCCAAGACTCCAGTGGGAGCAAAGAAGTCTAGCGAGATGGGCCCAACAATGTATCAAATAA

Network for GWHGAAZE021598

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	1	158	3.60E-34

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CrRLK1L-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.479
	SRR3591706	second leaf	0.127
	SRR3591707	mature leaf	0.492
	SRR3591708	Shoot apex	0.126
	SRR3591709	Stem	0.398
	SRR3591710	White floral bud	1.299
	SRR3591711	White flower	0.983
	SRR3591712	Green floral bud	0.223
	SRR3591713	Yellow flower	0.966
SRP173429	SRR8316895	Juvenile bud stage	1.193
	SRR8316896	Juvenile bud stage	0.771
	SRR8316897	Juvenile bud stage	0.776
	SRR8316894	Third green stage	1.705
	SRR8316900	Third green stage	1.525
	SRR8316901	Third green stage	1.127
	SRR8316898	Complete white stage	0.489
	SRR8316899	Complete white stage	3.658
	SRR8316903	Complete white stage	0.537
	SRR8316902	Silver flowering stage	0.699
	SRR8316904	Silver flowering stage	1.461
	SRR8316905	Silver flowering stage	0.391
	SRR8316906	Gold flowering stage	1.369
	SRR8316907	Gold flowering stage	1.576
	SRR8316908	Gold flowering stage	0.606
SRP132670	SRR6706286	Control	2.143
	SRR6706287	Light intensity 50%	2.869
	SRR6706288	Light intensity 20%	1.926
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.106
	CNS0095593	Slightly white alabastrum(diploid) 2	0.696
	CNS0095594	Slightly white alabastrum(diploid) 3	1.068
	CNS0095595	Whole white alabastrum(diploid) 2	1.008
	CNS0095596	Whole white alabastrum(diploid) 3	0.114
	CNS0095597	Whole white alabastrum(diploid) 4	0.133
	CNS0095598	Silvery flower (diploied) 1	0.162
	CNS0095599	Silvery flower (diploied) 2	1.571
	CNS0095600	Silvery flower (diploied) 3	1.692
	CNS0095601	Golden flower (diploid) 1	0.454
	CNS0095602	Golden flower (diploid) 2	1.846
	CNS0095603	Golden flower (diploid) 3	1.970
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.313
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.330
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.531
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.867
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.697
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.218
	CNS0095610	Silvery flower (tetraploid) 1	1.446
	CNS0095611	Silvery flower (tetraploid) 2	1.286
	CNS0095612	Silvery flower (tetraploid) 3	2.671
	CNS0095613	Golden flower (tetraploid) 1	1.726
	CNS0095614	Golden flower (tetraploid) 2	1.516
	CNS0095615	Golden flower (tetraploid) 3	1.450
CRA001975	CRR073297	Stem 1	0.724
	CRR073298	Stem 2	0.225
	CRR073299	Stem 3	0.115
	CRR073300	Leaf 1	1.867
	CRR073301	Leaf 2	0.293
	CRR073302	Leaf 3	0.416
	CRR073303	Juvenile bud 1	2.001
	CRR073304	Juvenile bud 2	0.566
	CRR073305	Juvenile bud 3	2.627
	CRR073306	Third green 1	0.154
	CRR073307	Third green 2	1.053
	CRR073308	Third green 3	0.343
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.273
	CRR073311	Second white 3	0.430
	CRR073312	Silver flowering 1	0.833
	CRR073313	Silver flowering 2	0.831
	CRR073314	Silver flowering 3	0.643
	CRR073315	Gold flowering 1	3.406
	CRR073316	Gold flowering 2	4.336
	CRR073317	Gold flowering 3	0.625
	CRR073318	Tawny withering 1	0.691
	CRR073319	Tawny withering 2	1.838
	CRR073320	Tawny withering 3	1.321