Gene detail

Detail information of GWHGAAZE021590

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO99003.1	1.12441E-76	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q8L4B2\|NFYC9_ARATH	3E-69	Nuclear transcription factor Y subunit C-9
trEMBL	tr\|A0A068TUH8\|A0A068TUH8_COFCA	4E-77	Coffea canephora DH200=94 genomic scaffold, scaffold_3 {ECO:0000313\|EMBL:CDO99003.1}
TAIR10	AT1G08970.4	8E-56	nuclear factor Y, subunit C9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	57485714	57486157	-
GWHAAZE00000006	mRNA	57485714	57486157	-
GWHAAZE00000006	exon	57485714	57486157	-
GWHAAZE00000006	CDS	57485714	57486157	-

Transcript Sequence
>GWHTAAZE021614 CTGCGGCTACAACTCCAGAACTTTTGGACAAAGCAACAACAAGATATTGAAAAAACGACCGATTTCAAGAACCACAGCCTCCCATTAGCGAGGATCAAGAAGATTATGAAAGCCGATGAGGATGTAAGGATGATAGCTGCCGAAGCTCCTGTAATATTTGCTCGGGCCTGTGAGATGTTCATCCTTGAGTTGACTTTGCGGGCTTGGAATCACACTGAGGAGAACAAGAGGAGGACCCTCCAAAAGAATGACATTTCTGCGGCCATCACAAGGACCGATATATTCGATTTCTTGATTGATATCGTCCCAAGGGAGGAGGTGGGTGAGAATGTACTTGCTGCATCAATTCCGAGGGGACCTTTTGCCTGTGGAGATCCAAATGAGGGGTATCCTTACTATTATTTGCCACAACAGCCAGTGGGGCCGTCAGGGATGTTTTTGGGT

Network for GWHGAAZE021590

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	26	89	3.20E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YC

KEGG pathway

KO	Enzyme	pathway	mapID
K08066	NFYC, HAP5	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.729
	SRR3591706	second leaf	6.592
	SRR3591707	mature leaf	15.515
	SRR3591708	Shoot apex	16.352
	SRR3591709	Stem	28.358
	SRR3591710	White floral bud	21.966
	SRR3591711	White flower	21.607
	SRR3591712	Green floral bud	14.109
	SRR3591713	Yellow flower	18.615
SRP173429	SRR8316895	Juvenile bud stage	13.362
	SRR8316896	Juvenile bud stage	18.897
	SRR8316897	Juvenile bud stage	9.006
	SRR8316894	Third green stage	7.491
	SRR8316900	Third green stage	21.805
	SRR8316901	Third green stage	16.751
	SRR8316898	Complete white stage	8.718
	SRR8316899	Complete white stage	20.734
	SRR8316903	Complete white stage	13.864
	SRR8316902	Silver flowering stage	8.699
	SRR8316904	Silver flowering stage	8.455
	SRR8316905	Silver flowering stage	5.321
	SRR8316906	Gold flowering stage	14.446
	SRR8316907	Gold flowering stage	16.937
	SRR8316908	Gold flowering stage	16.953
SRP132670	SRR6706286	Control	15.842
	SRR6706287	Light intensity 50%	17.881
	SRR6706288	Light intensity 20%	20.012
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	21.432
	CNS0095593	Slightly white alabastrum(diploid) 2	19.338
	CNS0095594	Slightly white alabastrum(diploid) 3	17.036
	CNS0095595	Whole white alabastrum(diploid) 2	15.026
	CNS0095596	Whole white alabastrum(diploid) 3	14.023
	CNS0095597	Whole white alabastrum(diploid) 4	14.142
	CNS0095598	Silvery flower (diploied) 1	38.872
	CNS0095599	Silvery flower (diploied) 2	25.677
	CNS0095600	Silvery flower (diploied) 3	23.829
	CNS0095601	Golden flower (diploid) 1	38.997
	CNS0095602	Golden flower (diploid) 2	21.154
	CNS0095603	Golden flower (diploid) 3	26.411
	CNS0095604	Slightly white alabastrum(tetraploid) 1	26.879
	CNS0095605	Slightly white alabastrum(tetraploid) 2	29.279
	CNS0095606	Slightly white alabastrum(tetraploid) 3	40.956
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.392
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.969
	CNS0095609	Whole white alabastrum(tetraploid) 3	23.601
	CNS0095610	Silvery flower (tetraploid) 1	37.434
	CNS0095611	Silvery flower (tetraploid) 2	28.248
	CNS0095612	Silvery flower (tetraploid) 3	33.816
	CNS0095613	Golden flower (tetraploid) 1	26.510
	CNS0095614	Golden flower (tetraploid) 2	33.302
	CNS0095615	Golden flower (tetraploid) 3	19.658
CRA001975	CRR073297	Stem 1	23.852
	CRR073298	Stem 2	21.126
	CRR073299	Stem 3	10.389
	CRR073300	Leaf 1	20.457
	CRR073301	Leaf 2	24.534
	CRR073302	Leaf 3	9.696
	CRR073303	Juvenile bud 1	7.268
	CRR073304	Juvenile bud 2	4.094
	CRR073305	Juvenile bud 3	11.296
	CRR073306	Third green 1	2.563
	CRR073307	Third green 2	2.321
	CRR073308	Third green 3	3.417
	CRR073309	Second white 1	2.513
	CRR073310	Second white 2	3.621
	CRR073311	Second white 3	4.980
	CRR073312	Silver flowering 1	3.186
	CRR073313	Silver flowering 2	5.084
	CRR073314	Silver flowering 3	5.306
	CRR073315	Gold flowering 1	3.976
	CRR073316	Gold flowering 2	5.308
	CRR073317	Gold flowering 3	1.144
	CRR073318	Tawny withering 1	18.886
	CRR073319	Tawny withering 2	17.614
	CRR073320	Tawny withering 3	24.427