Gene detail

Detail information of GWHGAAZE021352

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001266161.1	1.5651E-111	60S ribosomal protein L11-like [Cicer arietinum]
COG	YP_003435583.1	3E-48	50S ribosomal protein L5
Swissprot	tr\|P46287\|RL11_MEDSA	3E-113	60S ribosomal protein L11
trEMBL	tr\|Q8GTE2\|Q8GTE2_CICAR	6E-112	Ribosomal protein RL5 {ECO:0000313\|EMBL:CAD56220.1}
TAIR10	AT2G42740.1	5E-76	ribosomal protein large subunit 16A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	49328082	49328657	-
GWHAAZE00000006	mRNA	49328082	49328657	-
GWHAAZE00000006	exon	49328082	49328657	-
GWHAAZE00000006	CDS	49328082	49328657	-

Transcript Sequence
>GWHTAAZE021376 ATGGCTTCAGAGAGGAAGCTTGCGAACCCCATGAAAGAGATCAAAGTCCAGAAACTCGTCCTCAACATCTCCGTCGGTGAAAGCGGAGATAGTCTCACTCGTGCTGCTAAGGTTTTGGAGCAATTGAGTGGGCAAACCCCTGTATTCTTCAAGGCGAGGTACACTGTGCAATCCTTTGGAATCAGGAGAAATGAGAAAATTGCATGCTATGTCACAGTTAGGGGAGACAAGGCTATGCAGCTTTTTGAGAGTGGCTTGAAGGTTAAGGAGTATGAGCTTTTGAGGCGCAACTTAAGTGATACTGGCTGTTTCGGGTTTGGTATTCAGGAGCACATCGATCTTGGTATCAAGTACGATCCATCAACGGGTATTTATGGGATGGAGTTCTATGTGGTGCTAGAACGGCCAGGGTACCGTGTGGGAAGACGCCGTAGGTGCAAAGCCCGTGTCGGTATCCAGCACAGAGTTACAAAGGATGATGCAATGAAATGGTTCTGTGGTAGTAGTTTCAAGTTTTGCCAGGGTGAGTGTGGGGAGTTGTATCAGTGTTTCTGTGTGTTTGAATCCAAAATATAA

Network for GWHGAAZE021352

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00281.20	Ribosomal_L5	9	62	1.90E-19
PF00673.22	Ribosomal_L5_C	66	164	2.60E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02868	RP-L11e, RPL11	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.829
	SRR3591706	second leaf	2.756
	SRR3591707	mature leaf	1.541
	SRR3591708	Shoot apex	7.678
	SRR3591709	Stem	4.428
	SRR3591710	White floral bud	5.920
	SRR3591711	White flower	7.697
	SRR3591712	Green floral bud	11.024
	SRR3591713	Yellow flower	8.467
SRP173429	SRR8316895	Juvenile bud stage	0.083
	SRR8316896	Juvenile bud stage	0.165
	SRR8316897	Juvenile bud stage	0.153
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.403
	SRR8316901	Third green stage	0.242
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.061
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.112
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.116
	SRR8316906	Gold flowering stage	0.069
	SRR8316907	Gold flowering stage	0.229
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.068
	SRR6706287	Light intensity 50%	0.018
	SRR6706288	Light intensity 20%	0.157
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.458
	CNS0095593	Slightly white alabastrum(diploid) 2	0.672
	CNS0095594	Slightly white alabastrum(diploid) 3	0.145
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.073
	CNS0095597	Whole white alabastrum(diploid) 4	0.134
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.223
	CNS0095600	Silvery flower (diploied) 3	0.069
	CNS0095601	Golden flower (diploid) 1	0.161
	CNS0095602	Golden flower (diploid) 2	0.183
	CNS0095603	Golden flower (diploid) 3	0.129
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.050
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.229
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.091
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.076
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.077
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.162
	CNS0095610	Silvery flower (tetraploid) 1	0.121
	CNS0095611	Silvery flower (tetraploid) 2	0.067
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.118
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.120
CRA001975	CRR073297	Stem 1	0.566
	CRR073298	Stem 2	0.582
	CRR073299	Stem 3	0.511
	CRR073300	Leaf 1	0.765
	CRR073301	Leaf 2	0.215
	CRR073302	Leaf 3	1.154
	CRR073303	Juvenile bud 1	0.765
	CRR073304	Juvenile bud 2	0.434
	CRR073305	Juvenile bud 3	0.149
	CRR073306	Third green 1	0.147
	CRR073307	Third green 2	0.176
	CRR073308	Third green 3	0.065
	CRR073309	Second white 1	0.069
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.294
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.080
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.015
	CRR073317	Gold flowering 3	0.012
	CRR073318	Tawny withering 1	0.904
	CRR073319	Tawny withering 2	0.257
	CRR073320	Tawny withering 3	1.226