Gene detail

Detail information of GWHGAAZE021267

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003537257.1	2.37848E-56	PREDICTED: 40S ribosomal protein S23-like isoform 1 [Glycine max]
COG	YP_004004208.1	3E-32	30S ribosomal protein S12
Swissprot	tr\|P46297\|RS23_FRAAN	7E-58	40S ribosomal protein S23
trEMBL	tr\|I3T6R1\|I3T6R1_MEDTR	9E-57	Uncharacterized protein {ECO:0000313\|EMBL:AFK48203.1}
TAIR10	AT5G02960.1	1E-42	Ribosomal protein S12/S23 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	41616224	41616948	+
GWHAAZE00000006	mRNA	41616224	41616948	+
GWHAAZE00000006	exon	41616224	41616351	+
GWHAAZE00000006	exon	41616482	41616608	+
GWHAAZE00000006	exon	41616808	41616948	+
GWHAAZE00000006	CDS	41616224	41616351	+
GWHAAZE00000006	CDS	41616482	41616608	+
GWHAAZE00000006	CDS	41616808	41616948	+

Transcript Sequence
>GWHTAAZE021291 AAGACTTGTGGAATGGGAGCTGATCGTAAGTTGAAGTCCCACCGTAGAAGGCAAAGATGGGTGACAAGTTTTACAAAAAATCTCATCTTGGAAATGAATGGAAAAAGCCTTTTGCAGGGTCTTCCCATTGGGATTGAGGCTAAGCAGTCCAACTCTACTATCACAAAGTTTGCTCGTGTTCAGCTGATTAAAAATGGGAAGAAGATTGCTGCCTTTGTATCCAATGATGGTTGCTTAAACTATATTGAGGAAAATGATGAAGTGTTGATTGCAGGATTCAAAAGGAAGGGGCATGCTGTGGGAGATATTCCTGGAGTGAAGTTCAAGGCTGTGAAGGTATCTGGTGTCTCTCTTTTTTATTTGTTCAATGAGAAGAAGGAGAAGCAAAGGTCTTAG

Network for GWHGAAZE021267

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00164.26	Ribosom_S12_S23	43	130	1.90E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02973	RP-S23e, RPS23	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.984
	SRR3591706	second leaf	7.955
	SRR3591707	mature leaf	8.338
	SRR3591708	Shoot apex	10.506
	SRR3591709	Stem	12.199
	SRR3591710	White floral bud	7.481
	SRR3591711	White flower	6.800
	SRR3591712	Green floral bud	10.463
	SRR3591713	Yellow flower	6.039
SRP173429	SRR8316895	Juvenile bud stage	7.496
	SRR8316896	Juvenile bud stage	13.015
	SRR8316897	Juvenile bud stage	6.456
	SRR8316894	Third green stage	5.486
	SRR8316900	Third green stage	11.566
	SRR8316901	Third green stage	10.713
	SRR8316898	Complete white stage	5.256
	SRR8316899	Complete white stage	19.203
	SRR8316903	Complete white stage	8.598
	SRR8316902	Silver flowering stage	5.014
	SRR8316904	Silver flowering stage	6.724
	SRR8316905	Silver flowering stage	2.428
	SRR8316906	Gold flowering stage	8.307
	SRR8316907	Gold flowering stage	5.816
	SRR8316908	Gold flowering stage	8.338
SRP132670	SRR6706286	Control	4.345
	SRR6706287	Light intensity 50%	3.913
	SRR6706288	Light intensity 20%	4.603
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.940
	CNS0095593	Slightly white alabastrum(diploid) 2	11.935
	CNS0095594	Slightly white alabastrum(diploid) 3	15.647
	CNS0095595	Whole white alabastrum(diploid) 2	14.239
	CNS0095596	Whole white alabastrum(diploid) 3	11.562
	CNS0095597	Whole white alabastrum(diploid) 4	10.198
	CNS0095598	Silvery flower (diploied) 1	15.840
	CNS0095599	Silvery flower (diploied) 2	16.126
	CNS0095600	Silvery flower (diploied) 3	2.593
	CNS0095601	Golden flower (diploid) 1	14.088
	CNS0095602	Golden flower (diploid) 2	3.212
	CNS0095603	Golden flower (diploid) 3	3.713
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.040
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.672
	CNS0095606	Slightly white alabastrum(tetraploid) 3	19.131
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.104
	CNS0095608	Whole white alabastrum(tetraploid) 2	11.289
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.438
	CNS0095610	Silvery flower (tetraploid) 1	11.369
	CNS0095611	Silvery flower (tetraploid) 2	5.020
	CNS0095612	Silvery flower (tetraploid) 3	9.964
	CNS0095613	Golden flower (tetraploid) 1	9.466
	CNS0095614	Golden flower (tetraploid) 2	8.306
	CNS0095615	Golden flower (tetraploid) 3	3.370
CRA001975	CRR073297	Stem 1	5.583
	CRR073298	Stem 2	5.620
	CRR073299	Stem 3	0.596
	CRR073300	Leaf 1	5.883
	CRR073301	Leaf 2	6.923
	CRR073302	Leaf 3	0.872
	CRR073303	Juvenile bud 1	1.579
	CRR073304	Juvenile bud 2	0.074
	CRR073305	Juvenile bud 3	1.289
	CRR073306	Third green 1	0.503
	CRR073307	Third green 2	0.097
	CRR073308	Third green 3	0.250
	CRR073309	Second white 1	0.363
	CRR073310	Second white 2	0.127
	CRR073311	Second white 3	0.971
	CRR073312	Silver flowering 1	0.467
	CRR073313	Silver flowering 2	0.514
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.609
	CRR073316	Gold flowering 2	0.716
	CRR073317	Gold flowering 3	0.198
	CRR073318	Tawny withering 1	2.625
	CRR073319	Tawny withering 2	3.702
	CRR073320	Tawny withering 3	1.671