Gene detail

Detail information of GWHGAAZE021017

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN73659.1	6.34339E-29	hypothetical protein VITISV_044129 [Vitis vinifera]
COG	YP_004468471.1	2E-10	NAD-dependent aldehyde dehydrogenase
Swissprot	tr\|Q8W033\|AL3I1_ARATH	1E-25	Aldehyde dehydrogenase family 3 member I1, chloroplastic (Precursor)
trEMBL	tr\|A5AQ13\|A5AQ13_VITVI	2E-29	Aldehyde dehydrogenase {ECO:0000256\|PIRNR:PIRNR036492}
TAIR10	AT4G34240.2	1E-22	aldehyde dehydrogenase 3I1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	31222081	31227725	-
GWHAAZE00000006	mRNA	31222081	31227725	-
GWHAAZE00000006	exon	31227575	31227725	-
GWHAAZE00000006	exon	31222441	31222572	-
GWHAAZE00000006	exon	31222081	31222327	-
GWHAAZE00000006	five_prime_UTR	31227616	31227725	-
GWHAAZE00000006	CDS	31227575	31227615	-
GWHAAZE00000006	CDS	31222441	31222572	-
GWHAAZE00000006	CDS	31222081	31222327	-

Transcript Sequence
>GWHTAAZE021041 CCACTAAAATTCCTTCCCTTCCTCCTCTGTACTGATTTATATGCACATACAATTCTATTTTACAGCAACAACTGAAACATTCACTCACCTGATTGATTGATAATATCATCATGATCAGTCTCTCAATTGATGTTGCTGCACTTCAATTAAGGTTTGGTTCTTGCACGAACAGCACTTTTCGAAGCTGTTCTATGAACAAAAGCATCTCATCAAGGCAACTACAACAGAGTCAACTTTCCTTTCCATACCATCACCGATCTTCCCGCTTCATCTGTTCCAATACTTGCTATGCAACTCTATCGTTAATAGCGGACGAAGAAAAGGAGGCATTTGATATCAAAAGAGCCGAGTTGCTAGTGAAAGACCTAAGGGAGATATTCCATACCGGCAAGACAAAGAACTATGAGTGGAGAGTGTCACAGTTAAAGAGTATTTTAAAGATGCTAGAAGAAAGGGAAAGGGATATCATTAAAGCTTTACACAAGGACCTTTCCAAACCTGAATTCGAAGCTTTTATCTCTGAGGTCTAA

Network for GWHGAAZE021017

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00128	ALDH	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Glycolysis / Gluconeogenesis	map00010
		Ascorbate and aldarate metabolism	map00053
		Pyruvate metabolism	map00620
		Fatty acid degradation	map00071
		Glycerolipid metabolism	map00561
		Valine, leucine and isoleucine degradation	map00280
		Lysine degradation	map00310
		Arginine and proline metabolism	map00330
		Histidine metabolism	map00340
		Tryptophan metabolism	map00380
		beta-Alanine metabolism	map00410
		Insect hormone biosynthesis	map00981
		Limonene and pinene degradation	map00903
		Chloroalkane and chloroalkene degradation	map00625

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.802
	SRR3591706	second leaf	0.139
	SRR3591707	mature leaf	0.329
	SRR3591708	Shoot apex	0.895
	SRR3591709	Stem	3.048
	SRR3591710	White floral bud	3.047
	SRR3591711	White flower	1.479
	SRR3591712	Green floral bud	4.172
	SRR3591713	Yellow flower	1.508
SRP173429	SRR8316895	Juvenile bud stage	1.603
	SRR8316896	Juvenile bud stage	1.675
	SRR8316897	Juvenile bud stage	1.067
	SRR8316894	Third green stage	1.002
	SRR8316900	Third green stage	3.281
	SRR8316901	Third green stage	2.583
	SRR8316898	Complete white stage	1.581
	SRR8316899	Complete white stage	9.811
	SRR8316903	Complete white stage	3.403
	SRR8316902	Silver flowering stage	1.499
	SRR8316904	Silver flowering stage	1.899
	SRR8316905	Silver flowering stage	0.590
	SRR8316906	Gold flowering stage	1.985
	SRR8316907	Gold flowering stage	1.381
	SRR8316908	Gold flowering stage	1.217
SRP132670	SRR6706286	Control	0.565
	SRR6706287	Light intensity 50%	0.752
	SRR6706288	Light intensity 20%	1.038
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.877
	CNS0095593	Slightly white alabastrum(diploid) 2	1.173
	CNS0095594	Slightly white alabastrum(diploid) 3	1.111
	CNS0095595	Whole white alabastrum(diploid) 2	0.375
	CNS0095596	Whole white alabastrum(diploid) 3	0.442
	CNS0095597	Whole white alabastrum(diploid) 4	0.604
	CNS0095598	Silvery flower (diploied) 1	0.159
	CNS0095599	Silvery flower (diploied) 2	2.044
	CNS0095600	Silvery flower (diploied) 3	2.720
	CNS0095601	Golden flower (diploid) 1	0.350
	CNS0095602	Golden flower (diploid) 2	1.310
	CNS0095603	Golden flower (diploid) 3	1.608
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.143
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.927
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.688
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.554
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.311
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.941
	CNS0095610	Silvery flower (tetraploid) 1	4.266
	CNS0095611	Silvery flower (tetraploid) 2	2.768
	CNS0095612	Silvery flower (tetraploid) 3	3.052
	CNS0095613	Golden flower (tetraploid) 1	1.153
	CNS0095614	Golden flower (tetraploid) 2	1.710
	CNS0095615	Golden flower (tetraploid) 3	1.662
CRA001975	CRR073297	Stem 1	0.700
	CRR073298	Stem 2	0.208
	CRR073299	Stem 3	0.361
	CRR073300	Leaf 1	1.554
	CRR073301	Leaf 2	0.422
	CRR073302	Leaf 3	0.228
	CRR073303	Juvenile bud 1	0.586
	CRR073304	Juvenile bud 2	0.399
	CRR073305	Juvenile bud 3	0.742
	CRR073306	Third green 1	0.068
	CRR073307	Third green 2	0.491
	CRR073308	Third green 3	0.043
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.346
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.500
	CRR073316	Gold flowering 2	0.459
	CRR073317	Gold flowering 3	0.041
	CRR073318	Tawny withering 1	0.267
	CRR073319	Tawny withering 2	1.234
	CRR073320	Tawny withering 3	0.280