Gene detail

Detail information of GWHGAAZE020935

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO67174.1	7.98717E-93	hypothetical protein CISIN_1g026587mg [Citrus sinensis]
COG	YP_005842405.1	3E-18	proteasome subunit Beta
Swissprot	tr\|Q8LD27\|PSB6_ARATH	1E-88	Proteasome subunit beta type-6 (Precursor)
trEMBL	tr\|A0A067FII4\|A0A067FII4_CITSI	3E-93	Uncharacterized protein {ECO:0000313\|EMBL:KDO67174.1}
TAIR10	AT4G31300.3	8E-71	N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	27509402	27515137	-
GWHAAZE00000006	mRNA	27509402	27515137	-
GWHAAZE00000006	exon	27509402	27509415	-
GWHAAZE00000006	exon	27509506	27509617	-
GWHAAZE00000006	exon	27510448	27510520	-
GWHAAZE00000006	exon	27512517	27512572	-
GWHAAZE00000006	exon	27514172	27514248	-
GWHAAZE00000006	exon	27515026	27515137	-
GWHAAZE00000006	CDS	27515026	27515137	-
GWHAAZE00000006	CDS	27514172	27514248	-
GWHAAZE00000006	CDS	27512517	27512572	-
GWHAAZE00000006	CDS	27510448	27510520	-
GWHAAZE00000006	CDS	27509506	27509617	-
GWHAAZE00000006	CDS	27509402	27509415	-

Transcript Sequence
>GWHTAAZE020959 ATGGATCCAACGATGGCTGATCTGAACGCACCTCATTCCATGGGGACCACCATCATCGGCGTTACCTACAACGGCGGTGTTGTCCTCGGCGCCGATTCCAGAACCAGCACCGGTGTATATGTTGCAAATAGAGCATCAGACAAAATCACTCAACTAACTGATAATGTCTACTTGTGCCGCTCTGGATCGGCTGCTGATTCACAAATTGTTTCTGACTATGTGCGCTACTTTCTCCATCAACATACGATACAGCTTGGGCAACCTGCCACTGTTAAGGTTGCAGCAAACCTTGTCAGGCTATTATCGTACAACAACAAGAATATGCTACAAACTGGACTTATAATTGGTGGATGGGACAAGCATGAAGGAGGTAAAATATATGGAGTGCCTCTCGGAGGTACAATTTTGGAGCAGCCTTTTACAATTGGAGTAATTGATACTTAA

Network for GWHGAAZE020935

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00227.27	Proteasome	14	141	4.80E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02738	PSMB6	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0004298	molecular_function	threonine-type endopeptidase activity
GO:0004175	molecular_function	endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	15.838
	SRR3591706	second leaf	2.740
	SRR3591707	mature leaf	1.407
	SRR3591708	Shoot apex	10.137
	SRR3591709	Stem	14.430
	SRR3591710	White floral bud	12.748
	SRR3591711	White flower	22.289
	SRR3591712	Green floral bud	17.237
	SRR3591713	Yellow flower	18.093
SRP173429	SRR8316895	Juvenile bud stage	7.822
	SRR8316896	Juvenile bud stage	13.673
	SRR8316897	Juvenile bud stage	6.082
	SRR8316894	Third green stage	5.291
	SRR8316900	Third green stage	14.694
	SRR8316901	Third green stage	11.217
	SRR8316898	Complete white stage	4.594
	SRR8316899	Complete white stage	12.556
	SRR8316903	Complete white stage	7.671
	SRR8316902	Silver flowering stage	4.954
	SRR8316904	Silver flowering stage	4.823
	SRR8316905	Silver flowering stage	2.348
	SRR8316906	Gold flowering stage	17.988
	SRR8316907	Gold flowering stage	13.507
	SRR8316908	Gold flowering stage	21.122
SRP132670	SRR6706286	Control	26.136
	SRR6706287	Light intensity 50%	29.102
	SRR6706288	Light intensity 20%	32.979
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.816
	CNS0095593	Slightly white alabastrum(diploid) 2	6.964
	CNS0095594	Slightly white alabastrum(diploid) 3	5.884
	CNS0095595	Whole white alabastrum(diploid) 2	6.236
	CNS0095596	Whole white alabastrum(diploid) 3	5.589
	CNS0095597	Whole white alabastrum(diploid) 4	4.877
	CNS0095598	Silvery flower (diploied) 1	3.836
	CNS0095599	Silvery flower (diploied) 2	5.012
	CNS0095600	Silvery flower (diploied) 3	10.808
	CNS0095601	Golden flower (diploid) 1	3.510
	CNS0095602	Golden flower (diploid) 2	10.292
	CNS0095603	Golden flower (diploid) 3	7.660
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.663
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.728
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.422
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.670
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.622
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.477
	CNS0095610	Silvery flower (tetraploid) 1	20.905
	CNS0095611	Silvery flower (tetraploid) 2	20.961
	CNS0095612	Silvery flower (tetraploid) 3	13.665
	CNS0095613	Golden flower (tetraploid) 1	8.980
	CNS0095614	Golden flower (tetraploid) 2	21.020
	CNS0095615	Golden flower (tetraploid) 3	15.071
CRA001975	CRR073297	Stem 1	14.723
	CRR073298	Stem 2	15.518
	CRR073299	Stem 3	16.800
	CRR073300	Leaf 1	14.593
	CRR073301	Leaf 2	16.260
	CRR073302	Leaf 3	22.578
	CRR073303	Juvenile bud 1	19.965
	CRR073304	Juvenile bud 2	23.668
	CRR073305	Juvenile bud 3	20.564
	CRR073306	Third green 1	6.403
	CRR073307	Third green 2	9.530
	CRR073308	Third green 3	6.214
	CRR073309	Second white 1	13.702
	CRR073310	Second white 2	10.229
	CRR073311	Second white 3	9.278
	CRR073312	Silver flowering 1	4.630
	CRR073313	Silver flowering 2	9.570
	CRR073314	Silver flowering 3	5.766
	CRR073315	Gold flowering 1	15.694
	CRR073316	Gold flowering 2	19.182
	CRR073317	Gold flowering 3	12.204
	CRR073318	Tawny withering 1	14.573
	CRR073319	Tawny withering 2	14.399
	CRR073320	Tawny withering 3	15.427