Gene detail

Detail information of GWHGAAZE020934

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO67175.1	8.97198E-42	hypothetical protein CISIN_1g026587mg [Citrus sinensis]
COG	YP_005842405.1	0.000000006	proteasome subunit Beta
Swissprot	tr\|Q8LD27\|PSB6_ARATH	1E-38	Proteasome subunit beta type-6 (Precursor)
trEMBL	tr\|A0A067FM53\|A0A067FM53_CITSI	3E-42	Uncharacterized protein {ECO:0000313\|EMBL:KDO67175.1}
TAIR10	AT4G31300.2	1E-31	N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	27496797	27503294	-
GWHAAZE00000006	mRNA	27496797	27503294	-
GWHAAZE00000006	exon	27503252	27503294	-
GWHAAZE00000006	exon	27503018	27503091	-
GWHAAZE00000006	exon	27501928	27502002	-
GWHAAZE00000006	exon	27500626	27500749	-
GWHAAZE00000006	exon	27496797	27497092	-
GWHAAZE00000006	CDS	27503252	27503294	-
GWHAAZE00000006	CDS	27503018	27503091	-
GWHAAZE00000006	CDS	27501928	27502002	-
GWHAAZE00000006	CDS	27500666	27500749	-
GWHAAZE00000006	three_prime_UTR	27500626	27500665	-
GWHAAZE00000006	three_prime_UTR	27496797	27497092	-

Transcript Sequence
>GWHTAAZE020958 ATGCAAAGAGAGCTTAATTTCATACCTTCCACCTCCAAGTTTGGCTCTGGGTCTACTTATTTGTATGGTTTCTTTGATCAAGAATGGAAAGAAGGGATGACAAAAGAGGAAGCTGAGAAATTAGTGGTGAAGGCAGTTTCTCTTGCAATTGCCCGAGATGGTGCTAGTGGCGGTGTTGTTCGGACTGTAACTATAAACTCAGAAGGAGTAGAAAGGAAATTCTACCCAGCCCACACATTGCCACTGTGGCATGAGGAGCTGGCCGCACATAATTAAGCTGCTCGATATACTATCGTCCACCTCTCCTGATCCAATGTTATGTGATCTTATTCATCAACGTGACACGGCAATTTAGTCATTTAATTGACACTTACCGTAGCTCCACTAGGGCAACTCTTGCCGGAGGCCTGCAAGCCCACAAGCCAGTACCTTGACCATCAAGAATGCCACCGAACCGTAACACCACTCACTCCCTCAAACAATAACCAATTCCCCGCGTTCCCTATAACCCCATAATCCGAAGGAGCCACGAGGTCCCATCAATGCGGATGGTTATGGCACTATTATTACATTGGCCGCGAAAATGTAGGCTTTGAATCAAGTACCTTCCAG

Network for GWHGAAZE020934

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00227.27	Proteasome	14	65	4.60E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02738	PSMB6	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0004175	molecular_function	endopeptidase activity
GO:0004298	molecular_function	threonine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.544
	SRR3591706	second leaf	0.988
	SRR3591707	mature leaf	0.515
	SRR3591708	Shoot apex	2.584
	SRR3591709	Stem	1.996
	SRR3591710	White floral bud	3.176
	SRR3591711	White flower	6.394
	SRR3591712	Green floral bud	5.836
	SRR3591713	Yellow flower	4.657
SRP173429	SRR8316895	Juvenile bud stage	2.058
	SRR8316896	Juvenile bud stage	2.987
	SRR8316897	Juvenile bud stage	1.429
	SRR8316894	Third green stage	1.001
	SRR8316900	Third green stage	3.853
	SRR8316901	Third green stage	2.841
	SRR8316898	Complete white stage	1.438
	SRR8316899	Complete white stage	4.525
	SRR8316903	Complete white stage	1.619
	SRR8316902	Silver flowering stage	0.907
	SRR8316904	Silver flowering stage	1.578
	SRR8316905	Silver flowering stage	0.476
	SRR8316906	Gold flowering stage	3.786
	SRR8316907	Gold flowering stage	2.183
	SRR8316908	Gold flowering stage	4.618
SRP132670	SRR6706286	Control	1.451
	SRR6706287	Light intensity 50%	1.825
	SRR6706288	Light intensity 20%	2.382
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.307
	CNS0095593	Slightly white alabastrum(diploid) 2	1.977
	CNS0095594	Slightly white alabastrum(diploid) 3	2.675
	CNS0095595	Whole white alabastrum(diploid) 2	1.777
	CNS0095596	Whole white alabastrum(diploid) 3	2.777
	CNS0095597	Whole white alabastrum(diploid) 4	2.896
	CNS0095598	Silvery flower (diploied) 1	3.121
	CNS0095599	Silvery flower (diploied) 2	1.588
	CNS0095600	Silvery flower (diploied) 3	2.916
	CNS0095601	Golden flower (diploid) 1	1.025
	CNS0095602	Golden flower (diploid) 2	2.767
	CNS0095603	Golden flower (diploid) 3	2.433
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.367
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.486
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.736
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.736
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.411
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.651
	CNS0095610	Silvery flower (tetraploid) 1	6.039
	CNS0095611	Silvery flower (tetraploid) 2	4.497
	CNS0095612	Silvery flower (tetraploid) 3	4.357
	CNS0095613	Golden flower (tetraploid) 1	4.093
	CNS0095614	Golden flower (tetraploid) 2	5.483
	CNS0095615	Golden flower (tetraploid) 3	2.934
CRA001975	CRR073297	Stem 1	1.787
	CRR073298	Stem 2	2.077
	CRR073299	Stem 3	2.242
	CRR073300	Leaf 1	3.259
	CRR073301	Leaf 2	1.540
	CRR073302	Leaf 3	2.560
	CRR073303	Juvenile bud 1	2.456
	CRR073304	Juvenile bud 2	2.953
	CRR073305	Juvenile bud 3	3.040
	CRR073306	Third green 1	0.253
	CRR073307	Third green 2	0.537
	CRR073308	Third green 3	0.466
	CRR073309	Second white 1	2.589
	CRR073310	Second white 2	1.635
	CRR073311	Second white 3	1.466
	CRR073312	Silver flowering 1	1.035
	CRR073313	Silver flowering 2	1.283
	CRR073314	Silver flowering 3	0.260
	CRR073315	Gold flowering 1	2.220
	CRR073316	Gold flowering 2	1.544
	CRR073317	Gold flowering 3	1.416
	CRR073318	Tawny withering 1	2.151
	CRR073319	Tawny withering 2	2.838
	CRR073320	Tawny withering 3	2.661