Gene detail

Detail information of GWHGAAZE020702

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011095360.1	2.64775E-20	PREDICTED: tryptophan synthase beta chain 1-like [Sesamum indicum]
COG	YP_007127407.1	4E-12	Tryptophan synthase beta chain
Swissprot	tr\|P43284\|TRPB2_MAIZE	3E-18	Tryptophan synthase beta chain 2, chloroplastic (Precursor; Fragment)
trEMBL	tr\|M5WTG6\|M5WTG6_PRUPE	3E-20	Uncharacterized protein {ECO:0000313\|EMBL:EMJ12603.1}
TAIR10	AT5G54810.1	2E-14	tryptophan synthase beta-subunit 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	18207501	18207887	-
GWHAAZE00000006	mRNA	18207501	18207887	-
GWHAAZE00000006	exon	18207501	18207887	-
GWHAAZE00000006	CDS	18207501	18207887	-

Transcript Sequence
>GWHTAAZE020726 TTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCAATTATTCCAAAACCCTACTCCCTCTCCTCATTAACCTCTTCTTCTTCCCAGTTCAAATTGCAAAGATATATGTTTTGCCCTTCCTTCACCACCAAACCCCTTTCATATCATGTGTTCTCACCAGTAATTCAGCTCAGTCAACAATGGGCCAAGAAGCTAAACCGCTTCTCCTCCGCCCCGACTCCTTCGGCCGCTTCAGCAAGTTCGGTGGCAAGTACGTTCCCGAAACCCTTATGCATGCTCTCACTCAGCTCGAAGCCGCTTTTCATTTACTCGCCGGGGACCATGAATTTCAGGTTTTCGACCTTCGTTCGGGTTTAGAGAGAGAACAAAAAAGGAAAAAAACTGGTTGA

Network for GWHGAAZE020702

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01696	trpB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of amino acids	map01230
		Glycine, serine and threonine metabolism	map00260
		Phenylalanine, tyrosine and tryptophan biosynthesis	map00400

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.243
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.064
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.070
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.068
	SRR8316897	Juvenile bud stage	0.158
	SRR8316894	Third green stage	0.085
	SRR8316900	Third green stage	0.147
	SRR8316901	Third green stage	0.182
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.108
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.112
	SRR6706287	Light intensity 50%	0.087
	SRR6706288	Light intensity 20%	0.043
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.084
	CNS0095593	Slightly white alabastrum(diploid) 2	0.042
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.333
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.086
	CNS0095600	Silvery flower (diploied) 3	0.103
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.023
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.091
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.335
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.072
	CRR073302	Leaf 3	0.032
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.018
	CRR073308	Third green 3	0.008
	CRR073309	Second white 1	0.007
	CRR073310	Second white 2	0.161
	CRR073311	Second white 3	0.138
	CRR073312	Silver flowering 1	0.064
	CRR073313	Silver flowering 2	0.059
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.296
	CRR073316	Gold flowering 2	1.692
	CRR073317	Gold flowering 3	1.126
	CRR073318	Tawny withering 1	0.085
	CRR073319	Tawny withering 2	0.893
	CRR073320	Tawny withering 3	0.000