Gene detail

Detail information of GWHGAAZE020572

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006307596.1	2.64091E-15	hypothetical protein CARUB_v10009219mg [Capsella rubella]
Swissprot	tr\|O04153\|CALR3_ARATH	6E-11	Calreticulin-3 (Precursor)
trEMBL	tr\|R0IDE5\|R0IDE5_9BRAS	1E-15	Uncharacterized protein {ECO:0000313\|EMBL:EOA40494.1}
TAIR10	AT1G08450.3	6E-12	calreticulin 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	10569421	10571220	+
GWHAAZE00000006	mRNA	10569421	10571220	+
GWHAAZE00000006	exon	10569421	10569564	+
GWHAAZE00000006	exon	10569659	10569706	+
GWHAAZE00000006	exon	10570542	10570626	+
GWHAAZE00000006	exon	10571195	10571220	+
GWHAAZE00000006	CDS	10569421	10569564	+
GWHAAZE00000006	CDS	10569659	10569706	+
GWHAAZE00000006	CDS	10570542	10570626	+
GWHAAZE00000006	CDS	10571195	10571220	+

Transcript Sequence
>GWHTAAZE020596 ATGCTTCGCTTTCGTAGATCAAGCTTTCTGAGAATTCAACTTATCTTCCACCAAAGTGAAAATATATTAACTTCCCTTCTCTTGCAGCCGGCAGATTGGGATGATAGAGAGTACATTGATGATCCTAATGATGCCAAACCGGAGGGAAGAAACAAAATTCCAACTGAGATACCTGATCCAAAGGCAAAAAAGCGGCTGACTGGGGCGAAGACGATGATGGGATATGGAGACCACCCAAAGTCCCGAATCCAGCCTACAAAGGACCATGGAGATAAAGACTTTGAAGATGACCCTGATCTGTAA

Network for GWHGAAZE020572

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00262.19	Calreticulin	21	64	1.50E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08057	CALR	Protein processing in endoplasmic reticulum	map04141
		Phagosome	map04145
		Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006457	biological_process	protein folding
GO:0005783	cellular_component	endoplasmic reticulum
GO:0005509	molecular_function	calcium ion binding
GO:0005515	molecular_function	protein binding
GO:0051082	molecular_function	unfolded protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.740
	SRR3591706	second leaf	1.326
	SRR3591707	mature leaf	2.320
	SRR3591708	Shoot apex	3.203
	SRR3591709	Stem	2.396
	SRR3591710	White floral bud	2.371
	SRR3591711	White flower	2.317
	SRR3591712	Green floral bud	3.724
	SRR3591713	Yellow flower	1.530
SRP173429	SRR8316895	Juvenile bud stage	14.642
	SRR8316896	Juvenile bud stage	19.408
	SRR8316897	Juvenile bud stage	0.858
	SRR8316894	Third green stage	5.505
	SRR8316900	Third green stage	27.740
	SRR8316901	Third green stage	22.832
	SRR8316898	Complete white stage	11.295
	SRR8316899	Complete white stage	28.866
	SRR8316903	Complete white stage	13.870
	SRR8316902	Silver flowering stage	3.556
	SRR8316904	Silver flowering stage	4.405
	SRR8316905	Silver flowering stage	3.552
	SRR8316906	Gold flowering stage	7.779
	SRR8316907	Gold flowering stage	6.952
	SRR8316908	Gold flowering stage	3.965
SRP132670	SRR6706286	Control	30.660
	SRR6706287	Light intensity 50%	17.069
	SRR6706288	Light intensity 20%	27.357
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.251
	CNS0095593	Slightly white alabastrum(diploid) 2	15.874
	CNS0095594	Slightly white alabastrum(diploid) 3	14.756
	CNS0095595	Whole white alabastrum(diploid) 2	11.857
	CNS0095596	Whole white alabastrum(diploid) 3	15.660
	CNS0095597	Whole white alabastrum(diploid) 4	7.707
	CNS0095598	Silvery flower (diploied) 1	18.249
	CNS0095599	Silvery flower (diploied) 2	14.630
	CNS0095600	Silvery flower (diploied) 3	11.605
	CNS0095601	Golden flower (diploid) 1	28.477
	CNS0095602	Golden flower (diploid) 2	22.740
	CNS0095603	Golden flower (diploid) 3	17.412
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.389
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.299
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.716
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.616
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.851
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.549
	CNS0095610	Silvery flower (tetraploid) 1	3.060
	CNS0095611	Silvery flower (tetraploid) 2	2.544
	CNS0095612	Silvery flower (tetraploid) 3	1.508
	CNS0095613	Golden flower (tetraploid) 1	0.818
	CNS0095614	Golden flower (tetraploid) 2	1.936
	CNS0095615	Golden flower (tetraploid) 3	0.358
CRA001975	CRR073297	Stem 1	15.930
	CRR073298	Stem 2	13.771
	CRR073299	Stem 3	12.263
	CRR073300	Leaf 1	18.016
	CRR073301	Leaf 2	16.386
	CRR073302	Leaf 3	13.409
	CRR073303	Juvenile bud 1	20.335
	CRR073304	Juvenile bud 2	14.355
	CRR073305	Juvenile bud 3	12.835
	CRR073306	Third green 1	1.424
	CRR073307	Third green 2	1.439
	CRR073308	Third green 3	1.268
	CRR073309	Second white 1	0.604
	CRR073310	Second white 2	0.033
	CRR073311	Second white 3	0.122
	CRR073312	Silver flowering 1	0.474
	CRR073313	Silver flowering 2	0.110
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	4.297
	CRR073316	Gold flowering 2	7.765
	CRR073317	Gold flowering 3	4.506
	CRR073318	Tawny withering 1	8.755
	CRR073319	Tawny withering 2	8.890
	CRR073320	Tawny withering 3	8.996