Gene detail

Detail information of GWHGAAZE020571

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHN29255.1	6.08045E-55	Calreticulin-3 [Glycine soja]
Swissprot	tr\|O04153\|CALR3_ARATH	2E-45	Calreticulin-3 (Precursor)
trEMBL	tr\|B7FM24\|B7FM24_MEDTR	7E-51	Putative uncharacterized protein {ECO:0000313\|EMBL:ACJ85807.1}
TAIR10	AT1G08450.2	5E-40	calreticulin 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	10563238	10564146	+
GWHAAZE00000006	mRNA	10563238	10564146	+
GWHAAZE00000006	exon	10563238	10563452	+
GWHAAZE00000006	exon	10563962	10564076	+
GWHAAZE00000006	exon	10564132	10564146	+
GWHAAZE00000006	CDS	10563238	10563452	+
GWHAAZE00000006	CDS	10563962	10564076	+
GWHAAZE00000006	CDS	10564132	10564146	+

Transcript Sequence
>GWHTAAZE020595 ATGATTACCCCAACTGTTGCAGGTATTCAGACATATAATGATGCCAAACATTTCGCCATATCTGCAAAGGTACCCGAGATCAGCAACAAGGACAGAACTCTTGTGGTTCAATACTCTATAAAGTTTGAACAGGATATCGAATGCGGTGGTGGTTACATTAAGCTTCATTCTGGCTATGTCAATCAGAAGAAATATGGTGGTGATACTCCCTACAGGCCTGATGCAACGTATAGTGTCCTTGTTGATAATCGCGAATTAGATTCTGGAAGCTTGTACACTGACTGGGATATCTTACCTCCTCCAAAAATCAAAGACATCCATGCAAAAAAGGTTACGAATGCATAA

Network for GWHGAAZE020571

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00262.19	Calreticulin	8	71	2.90E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08057	CALR	Protein processing in endoplasmic reticulum	map04141
		Phagosome	map04145
		Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0006457	biological_process	protein folding
GO:0005783	cellular_component	endoplasmic reticulum
GO:0005509	molecular_function	calcium ion binding
GO:0051082	molecular_function	unfolded protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	61.528
	SRR3591706	second leaf	50.063
	SRR3591707	mature leaf	50.884
	SRR3591708	Shoot apex	63.807
	SRR3591709	Stem	56.070
	SRR3591710	White floral bud	49.655
	SRR3591711	White flower	44.388
	SRR3591712	Green floral bud	88.778
	SRR3591713	Yellow flower	33.049
SRP173429	SRR8316895	Juvenile bud stage	22.794
	SRR8316896	Juvenile bud stage	27.901
	SRR8316897	Juvenile bud stage	15.092
	SRR8316894	Third green stage	11.954
	SRR8316900	Third green stage	44.250
	SRR8316901	Third green stage	40.637
	SRR8316898	Complete white stage	15.981
	SRR8316899	Complete white stage	73.291
	SRR8316903	Complete white stage	22.913
	SRR8316902	Silver flowering stage	7.753
	SRR8316904	Silver flowering stage	9.117
	SRR8316905	Silver flowering stage	5.124
	SRR8316906	Gold flowering stage	15.531
	SRR8316907	Gold flowering stage	11.867
	SRR8316908	Gold flowering stage	20.839
SRP132670	SRR6706286	Control	25.462
	SRR6706287	Light intensity 50%	25.352
	SRR6706288	Light intensity 20%	28.321
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	27.561
	CNS0095593	Slightly white alabastrum(diploid) 2	26.098
	CNS0095594	Slightly white alabastrum(diploid) 3	20.511
	CNS0095595	Whole white alabastrum(diploid) 2	22.920
	CNS0095596	Whole white alabastrum(diploid) 3	22.735
	CNS0095597	Whole white alabastrum(diploid) 4	19.524
	CNS0095598	Silvery flower (diploied) 1	35.488
	CNS0095599	Silvery flower (diploied) 2	27.634
	CNS0095600	Silvery flower (diploied) 3	29.932
	CNS0095601	Golden flower (diploid) 1	44.041
	CNS0095602	Golden flower (diploid) 2	39.917
	CNS0095603	Golden flower (diploid) 3	38.214
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.247
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.566
	CNS0095606	Slightly white alabastrum(tetraploid) 3	58.586
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.146
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.797
	CNS0095609	Whole white alabastrum(tetraploid) 3	46.384
	CNS0095610	Silvery flower (tetraploid) 1	35.969
	CNS0095611	Silvery flower (tetraploid) 2	41.870
	CNS0095612	Silvery flower (tetraploid) 3	22.058
	CNS0095613	Golden flower (tetraploid) 1	9.785
	CNS0095614	Golden flower (tetraploid) 2	24.016
	CNS0095615	Golden flower (tetraploid) 3	4.095
CRA001975	CRR073297	Stem 1	19.690
	CRR073298	Stem 2	21.407
	CRR073299	Stem 3	14.301
	CRR073300	Leaf 1	31.025
	CRR073301	Leaf 2	21.850
	CRR073302	Leaf 3	19.326
	CRR073303	Juvenile bud 1	27.027
	CRR073304	Juvenile bud 2	24.948
	CRR073305	Juvenile bud 3	17.127
	CRR073306	Third green 1	2.918
	CRR073307	Third green 2	3.920
	CRR073308	Third green 3	2.939
	CRR073309	Second white 1	1.944
	CRR073310	Second white 2	1.733
	CRR073311	Second white 3	1.511
	CRR073312	Silver flowering 1	0.331
	CRR073313	Silver flowering 2	0.702
	CRR073314	Silver flowering 3	0.672
	CRR073315	Gold flowering 1	15.699
	CRR073316	Gold flowering 2	19.860
	CRR073317	Gold flowering 3	19.775
	CRR073318	Tawny withering 1	18.567
	CRR073319	Tawny withering 2	23.197
	CRR073320	Tawny withering 3	15.683