Gene detail

Detail information of GWHGAAZE020531

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05771.1	3.56448E-54	unnamed protein product [Coffea canephora]
Swissprot	tr\|F4I6M1\|POLIA_ARATH	3E-53	DNA polymerase I A, chloroplastic/mitochondrial (Precursor)
trEMBL	tr\|A0A068UBD4\|A0A068UBD4_COFCA	1E-54	Coffea canephora DH200=94 genomic scaffold, scaffold_19 {ECO:0000313\|EMBL:CDP05771.1}
TAIR10	AT1G50840.1	3E-47	polymerase gamma 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	8313467	8314562	-
GWHAAZE00000006	mRNA	8313467	8314562	-
GWHAAZE00000006	exon	8313467	8313497	-
GWHAAZE00000006	exon	8313966	8314225	-
GWHAAZE00000006	exon	8314320	8314562	-
GWHAAZE00000006	CDS	8314320	8314562	-
GWHAAZE00000006	CDS	8313966	8314225	-
GWHAAZE00000006	CDS	8313467	8313497	-

Transcript Sequence
>GWHTAAZE020555 ATGCATATGGCTAATTTATGGGATTCTTCGCGAGGAAAAAAAGGTAGTTATTCCCTAGAAGCACTTACAAGTGACCCTGTTGTAATGTCTGATTCAAGGTTGTATGCTGACGAGAAACCGATTGGTGAAGTATCACTGGAAGCCATCTTTGGGAGGAGAACGGTGAAGACAGATGGATTTCCAGGAAAAAATATCACCGTTCCTCCGGTTGAAGGTCTTGAAAGAATAGAGCGGAATCTTTGGTTAAACATGTTTGACTTTTACGAGAGATCTTGGCATCTGTATAGTGAAGTTGTAGTGAAGATGGAAAGTGCAGGGATCCTGATCGATCAAGCCCATCTTGCAGAGGTTGATAAACTGGCTAAAGCTGAGCAGCAAATTGCTGCTGATAGATTTCTCAACTGGGCATCTAAGTACTGTTCAGATGCCAAGTACATGAACATACGAAGTGAACCACAGTTGTGCCAGTTTTTTTTTGGTGGCGTTAGGAACAGGTATATTAAATTTGTACTCAGGATGCCCCAGAAAAACTGA

Network for GWHGAAZE020531

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02335	polA	DNA replication	map03030
		Base excision repair	map03410
		Nucleotide excision repair	map03420
		Homologous recombination	map03440

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.088
	SRR3591706	second leaf	0.824
	SRR3591707	mature leaf	1.561
	SRR3591708	Shoot apex	3.606
	SRR3591709	Stem	3.043
	SRR3591710	White floral bud	2.268
	SRR3591711	White flower	2.573
	SRR3591712	Green floral bud	2.827
	SRR3591713	Yellow flower	3.278
SRP173429	SRR8316895	Juvenile bud stage	0.194
	SRR8316896	Juvenile bud stage	0.313
	SRR8316897	Juvenile bud stage	3.769
	SRR8316894	Third green stage	0.179
	SRR8316900	Third green stage	0.992
	SRR8316901	Third green stage	0.728
	SRR8316898	Complete white stage	0.170
	SRR8316899	Complete white stage	0.040
	SRR8316903	Complete white stage	0.142
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.506
	SRR8316905	Silver flowering stage	0.095
	SRR8316906	Gold flowering stage	0.143
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	1.738
SRP132670	SRR6706286	Control	0.004
	SRR6706287	Light intensity 50%	0.182
	SRR6706288	Light intensity 20%	0.185
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.347
	CNS0095593	Slightly white alabastrum(diploid) 2	0.036
	CNS0095594	Slightly white alabastrum(diploid) 3	0.393
	CNS0095595	Whole white alabastrum(diploid) 2	0.490
	CNS0095596	Whole white alabastrum(diploid) 3	0.078
	CNS0095597	Whole white alabastrum(diploid) 4	0.291
	CNS0095598	Silvery flower (diploied) 1	0.241
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.337
	CNS0095601	Golden flower (diploid) 1	0.251
	CNS0095602	Golden flower (diploid) 2	0.957
	CNS0095603	Golden flower (diploid) 3	0.441
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.436
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.457
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.223
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.810
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.565
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.439
	CNS0095610	Silvery flower (tetraploid) 1	2.756
	CNS0095611	Silvery flower (tetraploid) 2	2.071
	CNS0095612	Silvery flower (tetraploid) 3	1.479
	CNS0095613	Golden flower (tetraploid) 1	1.244
	CNS0095614	Golden flower (tetraploid) 2	2.969
	CNS0095615	Golden flower (tetraploid) 3	3.911
CRA001975	CRR073297	Stem 1	0.064
	CRR073298	Stem 2	0.148
	CRR073299	Stem 3	0.018
	CRR073300	Leaf 1	0.195
	CRR073301	Leaf 2	0.775
	CRR073302	Leaf 3	0.619
	CRR073303	Juvenile bud 1	0.005
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.125
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.154
	CRR073309	Second white 1	0.061
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000