Gene detail

Detail information of GWHGAAZE020453

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007223734.1	3.5242E-108	hypothetical protein PRUPE_ppa010446mg [Prunus persica]
Swissprot	tr\|Q8L9G7\|APH1_ARATH	3E-100	Gamma-secretase subunit APH1-like
trEMBL	tr\|M5XTL9\|M5XTL9_PRUPE	1E-108	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24933.1}
TAIR10	AT2G31440.1	9E-62	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	5656920	5667152	+
GWHAAZE00000006	mRNA	5656920	5667152	+
GWHAAZE00000006	exon	5656920	5657166	+
GWHAAZE00000006	exon	5663565	5663650	+
GWHAAZE00000006	exon	5665781	5665906	+
GWHAAZE00000006	exon	5666103	5666230	+
GWHAAZE00000006	exon	5666988	5667152	+
GWHAAZE00000006	five_prime_UTR	5656920	5657053	+
GWHAAZE00000006	CDS	5657054	5657166	+
GWHAAZE00000006	CDS	5663565	5663650	+
GWHAAZE00000006	CDS	5665781	5665906	+
GWHAAZE00000006	CDS	5666103	5666230	+
GWHAAZE00000006	CDS	5666988	5667152	+

Transcript Sequence
>GWHTAAZE020475 TTTTTTTTTCATTTGGAATCTTTCGTCCCAAACGCAGGGTTTGAATAGCTCGGCGAAGACGAAGACCAGACACAGTAATTCCAATTGATTTTGCAGAAAGAACGCCATAGCCAGAGAGAGAGAGAGGTATTATTATGACAGTGGCTGCAGGGATTGGGTACGCACTGCTAGCCCTAGGCCCTTCTCTTTCCCTCTTCGTCACTCTCATCTCCAGTAAGCCTTTCTTGATCCTCATCCTTCTCTCCAGGAGGCTGGAAGATATGTTGGATTCTTTTGCTGACAGAGTATCTAAACCCCGCCTCTATCTGACAGATAAGATGCAAATCGCTCTTGCTGGTGGTTTGGGTCATGGTGTGGCACATGCTGTCTTTTTCTGCCTTAGCCTCTTAACCCCAGCTTTTGGTCCAGCTACTTATTATGTGGACAAGTGCTCGCAAATGCCATTCTTTCTTGTCTCTTCAGTTATCGCTCTCGCATTTGTCACAATCCACACGTTCTCGATGGTCATTGCATTCAATGGATATGCAGAACATACTAAAGTGGACCAATTGTTCGTTCCCATAGTTCACCTGGTTTCGGGATTGTTGACACTAACAAATCTTGTATCTGGAGGGTGTGTTATCGGAATCCCACTTCTGTATTTCATGGCGATCGTGACCTTATTACACTGTGGGAAGATGGTTTGGAGGAGATTAACTGAAAACCAAAGCAGGCTGTCGACTACCACCGGTACCAGCTCACTAGTATTGTAA

Network for GWHGAAZE020453

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06105.13	Aph-1	2	37	2.50E-06
PF06105.13	Aph-1	38	185	1.00E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06172	APH1A	Notch signaling pathway	map04330

Gene Ontology

GO term	Ontology	Name
GO:0016485	biological_process	protein processing
GO:0043085	biological_process	positive regulation of catalytic activity
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.823
	SRR3591706	second leaf	11.633
	SRR3591707	mature leaf	11.042
	SRR3591708	Shoot apex	19.426
	SRR3591709	Stem	14.672
	SRR3591710	White floral bud	20.743
	SRR3591711	White flower	21.845
	SRR3591712	Green floral bud	23.964
	SRR3591713	Yellow flower	20.760
SRP173429	SRR8316895	Juvenile bud stage	13.946
	SRR8316896	Juvenile bud stage	17.612
	SRR8316897	Juvenile bud stage	14.011
	SRR8316894	Third green stage	7.970
	SRR8316900	Third green stage	21.611
	SRR8316901	Third green stage	23.215
	SRR8316898	Complete white stage	10.785
	SRR8316899	Complete white stage	27.502
	SRR8316903	Complete white stage	12.670
	SRR8316902	Silver flowering stage	10.847
	SRR8316904	Silver flowering stage	12.162
	SRR8316905	Silver flowering stage	5.426
	SRR8316906	Gold flowering stage	22.440
	SRR8316907	Gold flowering stage	22.377
	SRR8316908	Gold flowering stage	27.823
SRP132670	SRR6706286	Control	12.248
	SRR6706287	Light intensity 50%	12.786
	SRR6706288	Light intensity 20%	14.050
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.854
	CNS0095593	Slightly white alabastrum(diploid) 2	21.352
	CNS0095594	Slightly white alabastrum(diploid) 3	23.573
	CNS0095595	Whole white alabastrum(diploid) 2	19.629
	CNS0095596	Whole white alabastrum(diploid) 3	22.565
	CNS0095597	Whole white alabastrum(diploid) 4	22.948
	CNS0095598	Silvery flower (diploied) 1	14.534
	CNS0095599	Silvery flower (diploied) 2	12.185
	CNS0095600	Silvery flower (diploied) 3	17.160
	CNS0095601	Golden flower (diploid) 1	16.432
	CNS0095602	Golden flower (diploid) 2	17.362
	CNS0095603	Golden flower (diploid) 3	16.367
	CNS0095604	Slightly white alabastrum(tetraploid) 1	34.782
	CNS0095605	Slightly white alabastrum(tetraploid) 2	33.874
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.815
	CNS0095607	Whole white alabastrum(tetraploid) 1	39.933
	CNS0095608	Whole white alabastrum(tetraploid) 2	35.604
	CNS0095609	Whole white alabastrum(tetraploid) 3	24.520
	CNS0095610	Silvery flower (tetraploid) 1	21.631
	CNS0095611	Silvery flower (tetraploid) 2	26.433
	CNS0095612	Silvery flower (tetraploid) 3	28.848
	CNS0095613	Golden flower (tetraploid) 1	17.917
	CNS0095614	Golden flower (tetraploid) 2	21.404
	CNS0095615	Golden flower (tetraploid) 3	20.953
CRA001975	CRR073297	Stem 1	13.560
	CRR073298	Stem 2	14.066
	CRR073299	Stem 3	17.196
	CRR073300	Leaf 1	16.906
	CRR073301	Leaf 2	15.653
	CRR073302	Leaf 3	16.246
	CRR073303	Juvenile bud 1	18.889
	CRR073304	Juvenile bud 2	14.967
	CRR073305	Juvenile bud 3	13.910
	CRR073306	Third green 1	8.681
	CRR073307	Third green 2	9.724
	CRR073308	Third green 3	9.691
	CRR073309	Second white 1	11.788
	CRR073310	Second white 2	10.498
	CRR073311	Second white 3	8.990
	CRR073312	Silver flowering 1	7.133
	CRR073313	Silver flowering 2	8.972
	CRR073314	Silver flowering 3	10.170
	CRR073315	Gold flowering 1	12.425
	CRR073316	Gold flowering 2	11.101
	CRR073317	Gold flowering 3	13.132
	CRR073318	Tawny withering 1	12.727
	CRR073319	Tawny withering 2	15.188
	CRR073320	Tawny withering 3	17.792