Gene detail

Detail information of GWHGAAZE020313

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002531521.1	5.98598E-45	6,7-dimethyl-8-ribityllumazine synthase, putative [Ricinus communis]
COG	YP_007838006.1	1E-24	6,7-dimethyl-8-ribityllumazine synthase
Swissprot	tr\|O80575\|RISB_ARATH	1E-42	6,7-dimethyl-8-ribityllumazine synthase, chloroplastic (Precursor)
trEMBL	tr\|B9SZV2\|B9SZV2_RICCO	2E-45	6,7-dimethyl-8-ribityllumazine synthase {ECO:0000256\|RuleBase:RU003795}
TAIR10	AT2G44050.1	6E-35	6,7-dimethyl-8-ribityllumazine synthase / DMRL synthase / lumazine synthase / riboflavin synthase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	83685019	83690524	+
GWHAAZE00000005	mRNA	83685019	83690524	+
GWHAAZE00000005	exon	83685019	83685021	+
GWHAAZE00000005	exon	83685159	83685281	+
GWHAAZE00000005	exon	83689790	83689868	+
GWHAAZE00000005	exon	83690099	83690145	+
GWHAAZE00000005	exon	83690450	83690524	+
GWHAAZE00000005	CDS	83685019	83685021	+
GWHAAZE00000005	CDS	83685159	83685281	+
GWHAAZE00000005	CDS	83689790	83689868	+
GWHAAZE00000005	CDS	83690099	83690145	+
GWHAAZE00000005	CDS	83690450	83690524	+

Transcript Sequence
>GWHTAAZE020335 ATGGCATCAGTTGTTGCCTTTCTTCAACAGGTTGTGTGGGTTCCTGGTAGTTTTGAAATTGGTCTAGTTGCAGAAAGGCTGGGGAAGTCAAGAAAGTATCAAGCAATTTTGTGTATTGGAGCTGTGGTAAGAGGTGATACTACCCACTATGATGCTGTAGCTAATTCGGCAGCATCTGGAGTACTCTCAGCAGGCCTGAATTCAGGAGTTCCTTGCATATTTGGTGTCTTGACATGTGAAGACATGGATCAGTTTGCACTTTTGGCCCTCATTGTTCTATATATTCATTTGATTTTCGTTTTTCTCAAGTTCCAACAATGGGCTTGA

Network for GWHGAAZE020313

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00885.20	DMRL_synthase	10	84	4.00E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00794	ribH, RIB4	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Riboflavin metabolism	map00740

Gene Ontology

GO term	Ontology	Name
GO:0009231	biological_process	riboflavin biosynthetic process
GO:0009349	cellular_component	riboflavin synthase complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.151
	SRR3591706	second leaf	51.906
	SRR3591707	mature leaf	34.806
	SRR3591708	Shoot apex	50.624
	SRR3591709	Stem	31.509
	SRR3591710	White floral bud	41.405
	SRR3591711	White flower	57.268
	SRR3591712	Green floral bud	43.203
	SRR3591713	Yellow flower	68.425
SRP173429	SRR8316895	Juvenile bud stage	25.325
	SRR8316896	Juvenile bud stage	37.187
	SRR8316897	Juvenile bud stage	9.079
	SRR8316894	Third green stage	11.285
	SRR8316900	Third green stage	58.068
	SRR8316901	Third green stage	54.500
	SRR8316898	Complete white stage	19.527
	SRR8316899	Complete white stage	53.345
	SRR8316903	Complete white stage	27.684
	SRR8316902	Silver flowering stage	21.407
	SRR8316904	Silver flowering stage	22.081
	SRR8316905	Silver flowering stage	11.561
	SRR8316906	Gold flowering stage	56.391
	SRR8316907	Gold flowering stage	44.732
	SRR8316908	Gold flowering stage	131.309
SRP132670	SRR6706286	Control	18.713
	SRR6706287	Light intensity 50%	20.048
	SRR6706288	Light intensity 20%	26.222
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	55.495
	CNS0095593	Slightly white alabastrum(diploid) 2	51.541
	CNS0095594	Slightly white alabastrum(diploid) 3	42.405
	CNS0095595	Whole white alabastrum(diploid) 2	44.933
	CNS0095596	Whole white alabastrum(diploid) 3	51.452
	CNS0095597	Whole white alabastrum(diploid) 4	49.229
	CNS0095598	Silvery flower (diploied) 1	40.609
	CNS0095599	Silvery flower (diploied) 2	47.378
	CNS0095600	Silvery flower (diploied) 3	31.859
	CNS0095601	Golden flower (diploid) 1	31.578
	CNS0095602	Golden flower (diploid) 2	31.707
	CNS0095603	Golden flower (diploid) 3	27.183
	CNS0095604	Slightly white alabastrum(tetraploid) 1	31.114
	CNS0095605	Slightly white alabastrum(tetraploid) 2	30.991
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.082
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.882
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.017
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.619
	CNS0095610	Silvery flower (tetraploid) 1	46.961
	CNS0095611	Silvery flower (tetraploid) 2	29.191
	CNS0095612	Silvery flower (tetraploid) 3	53.957
	CNS0095613	Golden flower (tetraploid) 1	85.910
	CNS0095614	Golden flower (tetraploid) 2	66.731
	CNS0095615	Golden flower (tetraploid) 3	62.817
CRA001975	CRR073297	Stem 1	17.948
	CRR073298	Stem 2	21.888
	CRR073299	Stem 3	17.379
	CRR073300	Leaf 1	27.779
	CRR073301	Leaf 2	25.800
	CRR073302	Leaf 3	22.057
	CRR073303	Juvenile bud 1	28.421
	CRR073304	Juvenile bud 2	27.951
	CRR073305	Juvenile bud 3	22.224
	CRR073306	Third green 1	15.411
	CRR073307	Third green 2	13.454
	CRR073308	Third green 3	15.644
	CRR073309	Second white 1	14.709
	CRR073310	Second white 2	11.284
	CRR073311	Second white 3	7.458
	CRR073312	Silver flowering 1	10.362
	CRR073313	Silver flowering 2	7.251
	CRR073314	Silver flowering 3	8.167
	CRR073315	Gold flowering 1	35.969
	CRR073316	Gold flowering 2	24.701
	CRR073317	Gold flowering 3	15.518
	CRR073318	Tawny withering 1	10.037
	CRR073319	Tawny withering 2	20.540
	CRR073320	Tawny withering 3	15.830