Gene detail

Detail information of GWHGAAZE020230

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004252070.1	6.71852E-74	PREDICTED: serine/threonine-protein kinase At5g01020-like [Solanum lycopersicum]
COG	YP_003831303.1	7E-16	PASTA domain-containing Ser/Thr protein kinase
Swissprot	tr\|P46573\|APK1B_ARATH	2E-68	Protein kinase APK1B, chloroplastic (Precursor)
trEMBL	tr\|K4DC19\|K4DC19_SOLLC	3E-74	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc12g009310.1.1}
TAIR10	AT2G28930.2	4E-57	protein kinase 1B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	80908278	80910364	-
GWHAAZE00000005	mRNA	80908278	80910364	-
GWHAAZE00000005	exon	80908278	80908582	-
GWHAAZE00000005	exon	80909734	80909857	-
GWHAAZE00000005	exon	80910263	80910364	-
GWHAAZE00000005	CDS	80910263	80910364	-
GWHAAZE00000005	CDS	80909734	80909857	-
GWHAAZE00000005	CDS	80908278	80908582	-

Transcript Sequence
>GWHTAAZE020252 ATGAAGATTGCTTTGGATGCTGCGAAAGGGCTTGCTTGTCTTCATGATAACGAAAAACTCCTTTATCGAGATTTCAAGACCTCAAATATCTTGTTGGATAAGGATTTTAATGCAAAGATTTCCGATTTTGGACTCGTCAAGAATGCGCCTGTGGGAGATCAAACTCATGTATCAACACGTGTTATGGGCACTTACGGATACGCAGCTCCTGAGTATATAATTACTGGTCATTTAACGGCAAAAAATGATGTATATGCATTTGGGGTGGTGCTACTCGAATTGTTGACCGGGAGGGCCGCCATCGACAGGAACAGGTCACCCATAGAGGAAAAGTTGGTCGATTTTGCGCTTCCTCGGCTAGTTGACTACAAGAAACTCCGGCCAATATTAGACCCACGATTAAAAGGCCAATATCGTCAAAAAGATATCGGCCCTGTGGTGATTCTTGCCCTCAAATGCCTTAGCAATGAAGCAAGAGATAGGCCAGTTATGAAGGAGGTTGTTCATATACTAGAAGCTGCTAAACCTTGA

Network for GWHGAAZE020230

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	3	169	4.50E-25

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIIa-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.530
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.220
	SRR3591708	Shoot apex	0.136
	SRR3591709	Stem	0.189
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.902
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	4.219
	SRR8316896	Juvenile bud stage	14.123
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	2.266
	SRR8316900	Third green stage	0.539
	SRR8316901	Third green stage	0.909
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.583
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.098
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.218
	SRR6706287	Light intensity 50%	0.518
	SRR6706288	Light intensity 20%	0.275
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.059
	CNS0095593	Slightly white alabastrum(diploid) 2	6.186
	CNS0095594	Slightly white alabastrum(diploid) 3	9.888
	CNS0095595	Whole white alabastrum(diploid) 2	1.859
	CNS0095596	Whole white alabastrum(diploid) 3	2.763
	CNS0095597	Whole white alabastrum(diploid) 4	1.108
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.221
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	22.576
	CNS0095605	Slightly white alabastrum(tetraploid) 2	21.865
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.231
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.658
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.226
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.635
	CNS0095610	Silvery flower (tetraploid) 1	0.102
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.399
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.040
	CNS0095615	Golden flower (tetraploid) 3	0.385
CRA001975	CRR073297	Stem 1	3.656
	CRR073298	Stem 2	3.200
	CRR073299	Stem 3	2.619
	CRR073300	Leaf 1	1.458
	CRR073301	Leaf 2	0.326
	CRR073302	Leaf 3	0.099
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.112
	CRR073305	Juvenile bud 3	0.047
	CRR073306	Third green 1	0.160
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.131
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.159
	CRR073320	Tawny withering 3	0.482