Gene detail

Detail information of GWHGAAZE020065

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004237369.1	4.68285E-36	PREDICTED: premnaspirodiene oxygenase [Solanum lycopersicum]
Swissprot	tr\|A6YIH8\|C7D55_HYOMU	9E-38	Premnaspirodiene oxygenase
trEMBL	tr\|K4BW28\|K4BW28_SOLLC	2E-36	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc04g083140.1.1}
TAIR10	AT4G31500.1	3E-10	cytochrome P450, family 83, subfamily B, polypeptide 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	75046139	75046597	+
GWHAAZE00000005	mRNA	75046139	75046597	+
GWHAAZE00000005	exon	75046139	75046597	+
GWHAAZE00000005	CDS	75046139	75046597	+

Transcript Sequence
>GWHTAAZE020087 GTTGATTCTATTCGCTCATCATCCTCCACAAGATCACCCGTTAATCTTACTGAAAAGATTAGCACATGGTCAAATGACATAGTCTGTAGAGCGACATTTGGGGCAAGATGTAAGGATGAAGTTTCCCTAATAAATCTCATCAAAGAGGCGGTATCTTTGGGAGGAGGTTTCGACGTGGCTGATTTGTTTCCTTCGTTCAAGTTTCTTCATGTCATTTTTGGGTTGAGGCCTAAGTTAGAGAAGCTGCAGCGAAAACTAGACCGGATCTATGACAGCATCTTCGATGAGTGCATAAAGAACTCAAAAGGGGGTAATACTGGTGATGTAGGGGAGGAAAATCTACTTCAAGTTCTATTAAGAATTAAAGATGGTGGTGGCCTTGAGTTTCCCATCACACTTGACAACGTCAAAGCTGTCATTTTGGTTAGTTTTGATTCACAGATTACATACGTTGCCTAA

Network for GWHGAAZE020065

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.484
	SRR3591706	second leaf	26.746
	SRR3591707	mature leaf	40.671
	SRR3591708	Shoot apex	12.774
	SRR3591709	Stem	20.425
	SRR3591710	White floral bud	1.310
	SRR3591711	White flower	2.035
	SRR3591712	Green floral bud	1.217
	SRR3591713	Yellow flower	0.215
SRP173429	SRR8316895	Juvenile bud stage	1.271
	SRR8316896	Juvenile bud stage	2.394
	SRR8316897	Juvenile bud stage	2.258
	SRR8316894	Third green stage	0.810
	SRR8316900	Third green stage	3.485
	SRR8316901	Third green stage	1.655
	SRR8316898	Complete white stage	0.433
	SRR8316899	Complete white stage	0.755
	SRR8316903	Complete white stage	1.515
	SRR8316902	Silver flowering stage	2.040
	SRR8316904	Silver flowering stage	3.987
	SRR8316905	Silver flowering stage	1.360
	SRR8316906	Gold flowering stage	6.300
	SRR8316907	Gold flowering stage	3.930
	SRR8316908	Gold flowering stage	12.465
SRP132670	SRR6706286	Control	0.467
	SRR6706287	Light intensity 50%	1.040
	SRR6706288	Light intensity 20%	0.656
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.615
	CNS0095593	Slightly white alabastrum(diploid) 2	3.500
	CNS0095594	Slightly white alabastrum(diploid) 3	4.428
	CNS0095595	Whole white alabastrum(diploid) 2	2.011
	CNS0095596	Whole white alabastrum(diploid) 3	1.112
	CNS0095597	Whole white alabastrum(diploid) 4	3.391
	CNS0095598	Silvery flower (diploied) 1	3.307
	CNS0095599	Silvery flower (diploied) 2	6.457
	CNS0095600	Silvery flower (diploied) 3	3.018
	CNS0095601	Golden flower (diploid) 1	6.808
	CNS0095602	Golden flower (diploid) 2	6.093
	CNS0095603	Golden flower (diploid) 3	6.893
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.457
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.132
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.370
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.525
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.068
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.222
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.065
	CNS0095613	Golden flower (tetraploid) 1	0.096
	CNS0095614	Golden flower (tetraploid) 2	0.094
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.979
	CRR073298	Stem 2	0.671
	CRR073299	Stem 3	0.131
	CRR073300	Leaf 1	0.772
	CRR073301	Leaf 2	1.158
	CRR073302	Leaf 3	0.957
	CRR073303	Juvenile bud 1	0.923
	CRR073304	Juvenile bud 2	0.270
	CRR073305	Juvenile bud 3	0.200
	CRR073306	Third green 1	1.989
	CRR073307	Third green 2	2.286
	CRR073308	Third green 3	2.555
	CRR073309	Second white 1	2.334
	CRR073310	Second white 2	3.086
	CRR073311	Second white 3	0.865
	CRR073312	Silver flowering 1	2.250
	CRR073313	Silver flowering 2	2.934
	CRR073314	Silver flowering 3	5.093
	CRR073315	Gold flowering 1	22.525
	CRR073316	Gold flowering 2	39.969
	CRR073317	Gold flowering 3	29.330
	CRR073318	Tawny withering 1	13.661
	CRR073319	Tawny withering 2	15.999
	CRR073320	Tawny withering 3	7.204