Gene detail

Detail information of GWHGAAZE019909

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAA79323.1	9.47382E-20	S-receptor kinase related protein [Brassica oleracea var. alboglabra]
Swissprot	tr\|O81832\|Y4729_ARATH	7E-20	G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290 (Precursor)
trEMBL	tr\|Q05969\|Q05969_BRAOL	4E-20	S-receptor kinase related protein {ECO:0000313\|EMBL:CAA79323.1} (Fragment)
TAIR10	AT4G27290.1	1E-18	S-locus lectin protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	67399529	67401410	+
GWHAAZE00000005	mRNA	67399529	67401410	+
GWHAAZE00000005	exon	67399529	67399661	+
GWHAAZE00000005	exon	67399777	67399962	+
GWHAAZE00000005	exon	67400111	67400229	+
GWHAAZE00000005	exon	67400362	67400458	+
GWHAAZE00000005	exon	67400722	67400842	+
GWHAAZE00000005	exon	67401218	67401410	+
GWHAAZE00000005	CDS	67399529	67399661	+
GWHAAZE00000005	CDS	67399777	67399962	+
GWHAAZE00000005	CDS	67400111	67400229	+
GWHAAZE00000005	CDS	67400362	67400458	+
GWHAAZE00000005	CDS	67400722	67400842	+
GWHAAZE00000005	CDS	67401218	67401410	+

Transcript Sequence
>GWHTAAZE019931 AAAGAGATCATTTTATTTGGCGGAGTTAGGCACGCGAATTCACTTGAACTTCTTGGGTATTGTATGGCCAAAGATGTTAGGATCTTAATCTTTGAGTTTATGCCCAATGGAGATCTTGATGATTTCTTTTTCGGACGAAACAAATCACGGAATGTGGATGTGTATAAGCGAATCGAACTTATACATGATGTTGCTTCCGGGCTAAATTACCTGCACAATGACTCCAAGGTCCGAATTGTCCATCGAGACATTAAACTGAAATGTTGGTACTTCGACAAAAAAATGGAATTGGCATTCTTGCTGATGCTCCTAAATGTTGTGGGAACAAATGGTGACAATTGCAATCTGGCAGCCTTTTGTAGGGCTGATATGCGGAATGCTATTGTTGCTTCCGAGGTCGAAATAAAAGTTATGGATCCAAACTCCTACTATCAGGATCAGTGCATCAGTTGTCTAGAAGTTGCTGGGACAACTATTCAAGTTATACTAAAAGACTGGGATAGGCAAAGTGTAGTAGTTTCATTCTACCCACAATGTAATAATAGTTTGAAGATCATCATTTCTGCCTGCGTTGTGATTTTCATGATTATTCTTTTTGTGGCCATATTCATATATAAAAGGAATCAAAAGAAGAAAAACAATACCACTAACAGAATTGGCATTGCCTCTCCCGAGAATGAGAAAGAGTTTCAGAAAGAGATCATTTTATTCGGCGGAGTTAGGCACGTGAACTTACTTGAACTTCTTGGGTATTGTATAGCCAAAGATGTTAGGATCTTGATCTTTGAGTTTATGCTCAATGGAGATCTTGATGATTTCTTATTTGGTACGATACCTTGGCATTTCTAG

Network for GWHGAAZE019909

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	2	86	1.70E-12
PF07714.18	PK_Tyr_Ser-Thr	223	274	8.70E-07

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	24.648
	SRR3591706	second leaf	18.218
	SRR3591707	mature leaf	10.618
	SRR3591708	Shoot apex	24.477
	SRR3591709	Stem	19.064
	SRR3591710	White floral bud	7.457
	SRR3591711	White flower	8.044
	SRR3591712	Green floral bud	11.175
	SRR3591713	Yellow flower	8.077
SRP173429	SRR8316895	Juvenile bud stage	11.168
	SRR8316896	Juvenile bud stage	12.442
	SRR8316897	Juvenile bud stage	5.126
	SRR8316894	Third green stage	10.959
	SRR8316900	Third green stage	32.046
	SRR8316901	Third green stage	26.699
	SRR8316898	Complete white stage	16.443
	SRR8316899	Complete white stage	41.120
	SRR8316903	Complete white stage	23.832
	SRR8316902	Silver flowering stage	14.974
	SRR8316904	Silver flowering stage	19.774
	SRR8316905	Silver flowering stage	5.949
	SRR8316906	Gold flowering stage	25.455
	SRR8316907	Gold flowering stage	29.273
	SRR8316908	Gold flowering stage	21.877
SRP132670	SRR6706286	Control	15.228
	SRR6706287	Light intensity 50%	16.943
	SRR6706288	Light intensity 20%	17.936
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.017
	CNS0095593	Slightly white alabastrum(diploid) 2	17.868
	CNS0095594	Slightly white alabastrum(diploid) 3	10.678
	CNS0095595	Whole white alabastrum(diploid) 2	18.749
	CNS0095596	Whole white alabastrum(diploid) 3	19.561
	CNS0095597	Whole white alabastrum(diploid) 4	18.345
	CNS0095598	Silvery flower (diploied) 1	16.622
	CNS0095599	Silvery flower (diploied) 2	7.052
	CNS0095600	Silvery flower (diploied) 3	20.258
	CNS0095601	Golden flower (diploid) 1	6.009
	CNS0095602	Golden flower (diploid) 2	15.496
	CNS0095603	Golden flower (diploid) 3	14.481
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	21.050
	CNS0095606	Slightly white alabastrum(tetraploid) 3	32.299
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.323
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.558
	CNS0095609	Whole white alabastrum(tetraploid) 3	31.467
	CNS0095610	Silvery flower (tetraploid) 1	20.039
	CNS0095611	Silvery flower (tetraploid) 2	11.480
	CNS0095612	Silvery flower (tetraploid) 3	17.518
	CNS0095613	Golden flower (tetraploid) 1	10.817
	CNS0095614	Golden flower (tetraploid) 2	14.743
	CNS0095615	Golden flower (tetraploid) 3	14.040
CRA001975	CRR073297	Stem 1	13.318
	CRR073298	Stem 2	12.862
	CRR073299	Stem 3	6.115
	CRR073300	Leaf 1	14.961
	CRR073301	Leaf 2	14.377
	CRR073302	Leaf 3	7.128
	CRR073303	Juvenile bud 1	7.293
	CRR073304	Juvenile bud 2	3.301
	CRR073305	Juvenile bud 3	6.646
	CRR073306	Third green 1	1.377
	CRR073307	Third green 2	1.669
	CRR073308	Third green 3	1.680
	CRR073309	Second white 1	2.097
	CRR073310	Second white 2	4.986
	CRR073311	Second white 3	3.186
	CRR073312	Silver flowering 1	3.616
	CRR073313	Silver flowering 2	1.300
	CRR073314	Silver flowering 3	3.029
	CRR073315	Gold flowering 1	3.666
	CRR073316	Gold flowering 2	5.335
	CRR073317	Gold flowering 3	1.700
	CRR073318	Tawny withering 1	10.776
	CRR073319	Tawny withering 2	9.227
	CRR073320	Tawny withering 3	9.121