Gene detail

Detail information of GWHGAAZE019576

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI39480.3	2.86508E-16	unnamed protein product [Vitis vinifera]
Swissprot	tr\|O04027\|NFYB4_ARATH	7E-13	Nuclear transcription factor Y subunit B-4
trEMBL	tr\|D7U9R6\|D7U9R6_VITVI	1E-16	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI39480.3}
TAIR10	AT1G09030.1	2E-10	nuclear factor Y, subunit B4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	51724637	51724885	+
GWHAAZE00000005	mRNA	51724637	51724885	+
GWHAAZE00000005	exon	51724637	51724885	+
GWHAAZE00000005	CDS	51724637	51724885	+

Transcript Sequence
>GWHTAAZE019598 ATGCCCGTCGGAGTTTGTCAGTTTTGTCATAGGCTAAGCGTCAAACAAGTGATAAAGGAAAATTGCAAGACCGTTAATGGTGACGATGTTTGCTGGGCTTGGAGCTCACTAGGGTTTGATGAGTGTGGTGAGGTTATAATGACGTATTTGCACAAGTATAGGGAGTTTGAAAGCGAGAGAGCCCAGAGAACAAAGGGTCTATATATTATAGAAGAAGAGAAATATGAAGATTCCATTTGTAGAGTTTGA

Network for GWHGAAZE019576

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08065	NFYB, HAP3	Antigen processing and presentation	map04612

Gene Ontology

GO term	Ontology	Name
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.369
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	1.877
	SRR8316901	Third green stage	1.164
	SRR8316898	Complete white stage	0.660
	SRR8316899	Complete white stage	2.437
	SRR8316903	Complete white stage	1.601
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.786
	SRR8316905	Silver flowering stage	0.364
	SRR8316906	Gold flowering stage	0.392
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.583
SRP132670	SRR6706286	Control	0.660
	SRR6706287	Light intensity 50%	1.416
	SRR6706288	Light intensity 20%	1.115
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.094
	CNS0095593	Slightly white alabastrum(diploid) 2	1.147
	CNS0095594	Slightly white alabastrum(diploid) 3	0.885
	CNS0095595	Whole white alabastrum(diploid) 2	0.703
	CNS0095596	Whole white alabastrum(diploid) 3	0.500
	CNS0095597	Whole white alabastrum(diploid) 4	3.763
	CNS0095598	Silvery flower (diploied) 1	0.680
	CNS0095599	Silvery flower (diploied) 2	0.849
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	1.649
	CNS0095602	Golden flower (diploid) 2	0.703
	CNS0095603	Golden flower (diploid) 3	0.041
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.168
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.288
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.161
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.289
	CNS0095610	Silvery flower (tetraploid) 1	0.802
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.214
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.245
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.246
	CRR073301	Leaf 2	0.759
	CRR073302	Leaf 3	1.665
	CRR073303	Juvenile bud 1	1.372
	CRR073304	Juvenile bud 2	4.318
	CRR073305	Juvenile bud 3	0.428
	CRR073306	Third green 1	0.605
	CRR073307	Third green 2	0.249
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.113
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000