Gene detail

Detail information of GWHGAAZE019534

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO53759.1	2.7175E-37	hypothetical protein CISIN_1g0048101mg, partial [Citrus sinensis]
trEMBL	tr\|A0A067EIR3\|A0A067EIR3_CITSI	1E-37	Uncharacterized protein {ECO:0000313\|EMBL:KDO53760.1} (Fragment)
TAIR10	AT3G57170.1	3E-15	N-acetylglucosaminyl transferase component family protein / Gpi1 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	49914481	49917883	-
GWHAAZE00000005	mRNA	49914481	49917883	-
GWHAAZE00000005	exon	49917759	49917883	-
GWHAAZE00000005	exon	49916641	49916906	-
GWHAAZE00000005	exon	49915307	49915400	-
GWHAAZE00000005	exon	49914481	49914601	-
GWHAAZE00000005	CDS	49917759	49917883	-
GWHAAZE00000005	CDS	49916641	49916906	-
GWHAAZE00000005	CDS	49915307	49915400	-
GWHAAZE00000005	CDS	49914481	49914601	-

Transcript Sequence
>GWHTAAZE019556 ATGGTCGAAGCTCCAGACACTGATGTAGTTGTCGTCGGCGGATTTGAGGGTGGCCAAGGCGTCGCCGACGGAGGAAGAGACGGAGAGAGACCGGAAATCAACTTTCCTCGATCTAGATCTGTGAAGGGTCAGAAGTGGAATCCTCTTCGACAGAGATTAGACAGCTACAATTACACTGTAGAGCAACATATCATTGGTTCTCTCCTCTTTACACCGCTGTTACTTTTACTGCCAACCACTTCTGCTTTGTACATTTTCTTCACCATTATGAACCGGTCCATTAGCTTTATCTGCATTTTCATTGAGGTCATTATATCCATTATTCATGCTACCCCCTACACCAAAATATTCCTTTGGTTGGTTAGGTCAAGAGATTCCCCTGTAGGATATGGACAAATAGTGTGGCCTCACTATAGATACATATATTCTGTGGTTTCGAGATCATATGTTGCTTCATCAACTTATGGAGTTCTAAGAGGAAGGAGATTATCGTCTTTAGAGTACTACAGTAGCATTCTAACTACTCCAGCAGGGACTAGTGGTCTTCCTTCAAAAAAGCCATGGATGATGCTCATTCCCGACAAGGAATCTTGGCCTTTGTTATGA

Network for GWHGAAZE019534

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05024.16	Gpi1	41	80	3.90E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03860	PIGQ, GPI1	Metabolic pathways	map01100
K03860	PIGQ, GPI1	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0016021	cellular_component	integral component of membrane
GO:0017176	molecular_function	phosphatidylinositol N-acetylglucosaminyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.310
	SRR3591706	second leaf	0.379
	SRR3591707	mature leaf	0.541
	SRR3591708	Shoot apex	0.587
	SRR3591709	Stem	0.597
	SRR3591710	White floral bud	0.397
	SRR3591711	White flower	0.694
	SRR3591712	Green floral bud	0.572
	SRR3591713	Yellow flower	0.472
SRP173429	SRR8316895	Juvenile bud stage	0.510
	SRR8316896	Juvenile bud stage	0.377
	SRR8316897	Juvenile bud stage	0.455
	SRR8316894	Third green stage	0.388
	SRR8316900	Third green stage	0.627
	SRR8316901	Third green stage	0.508
	SRR8316898	Complete white stage	0.119
	SRR8316899	Complete white stage	0.807
	SRR8316903	Complete white stage	0.349
	SRR8316902	Silver flowering stage	0.305
	SRR8316904	Silver flowering stage	0.206
	SRR8316905	Silver flowering stage	0.036
	SRR8316906	Gold flowering stage	0.086
	SRR8316907	Gold flowering stage	0.121
	SRR8316908	Gold flowering stage	0.669
SRP132670	SRR6706286	Control	0.447
	SRR6706287	Light intensity 50%	0.792
	SRR6706288	Light intensity 20%	0.942
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.393
	CNS0095593	Slightly white alabastrum(diploid) 2	0.663
	CNS0095594	Slightly white alabastrum(diploid) 3	0.294
	CNS0095595	Whole white alabastrum(diploid) 2	0.461
	CNS0095596	Whole white alabastrum(diploid) 3	0.099
	CNS0095597	Whole white alabastrum(diploid) 4	0.593
	CNS0095598	Silvery flower (diploied) 1	0.324
	CNS0095599	Silvery flower (diploied) 2	0.184
	CNS0095600	Silvery flower (diploied) 3	0.493
	CNS0095601	Golden flower (diploid) 1	0.180
	CNS0095602	Golden flower (diploid) 2	0.502
	CNS0095603	Golden flower (diploid) 3	0.444
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.624
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.468
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.858
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.049
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.597
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.507
	CNS0095610	Silvery flower (tetraploid) 1	0.588
	CNS0095611	Silvery flower (tetraploid) 2	0.568
	CNS0095612	Silvery flower (tetraploid) 3	1.086
	CNS0095613	Golden flower (tetraploid) 1	0.301
	CNS0095614	Golden flower (tetraploid) 2	0.385
	CNS0095615	Golden flower (tetraploid) 3	0.653
CRA001975	CRR073297	Stem 1	0.807
	CRR073298	Stem 2	0.403
	CRR073299	Stem 3	0.074
	CRR073300	Leaf 1	0.578
	CRR073301	Leaf 2	0.558
	CRR073302	Leaf 3	0.139
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.228
	CRR073305	Juvenile bud 3	0.212
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.042
	CRR073309	Second white 1	0.014
	CRR073310	Second white 2	0.084
	CRR073311	Second white 3	0.046
	CRR073312	Silver flowering 1	0.137
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.182
	CRR073315	Gold flowering 1	0.057
	CRR073316	Gold flowering 2	0.059
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.440
	CRR073319	Tawny withering 2	0.302
	CRR073320	Tawny withering 3	0.429