Gene detail

Detail information of GWHGAAZE019418

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI39515.3	8.35353E-95	unnamed protein product [Vitis vinifera]
Swissprot	tr\|O82631\|CAPZA_ARATH	2E-79	F-actin-capping protein subunit alpha
trEMBL	tr\|A5AD20\|A5AD20_VITVI	5E-95	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN68894.1}
TAIR10	AT3G05520.2	9E-65	Subunits of heterodimeric actin filament capping protein Capz superfamily

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	42015027	42018094	-
GWHAAZE00000005	mRNA	42015027	42018094	-
GWHAAZE00000005	exon	42015027	42015134	-
GWHAAZE00000005	exon	42015773	42015847	-
GWHAAZE00000005	exon	42016367	42016444	-
GWHAAZE00000005	exon	42016982	42017060	-
GWHAAZE00000005	exon	42017790	42017948	-
GWHAAZE00000005	exon	42018072	42018094	-
GWHAAZE00000005	CDS	42018072	42018094	-
GWHAAZE00000005	CDS	42017790	42017948	-
GWHAAZE00000005	CDS	42016982	42017060	-
GWHAAZE00000005	CDS	42016367	42016444	-
GWHAAZE00000005	CDS	42015773	42015847	-
GWHAAZE00000005	CDS	42015027	42015134	-

Transcript Sequence
>GWHTAAZE019440 ATGTACCTCAGTACATCTGCAGTATGTGCAGTGGATGCAGAAATCGGCAAATACGTTGGAGATGCTTATCCAAAAGGTGTCTATTCAGTTTACTGTACGAGTGGAAAAGATAGTGAACTGGGATCTGATTTTGAGTTTGTTGCGGTGATTTCAGCCACCCGACACAGCCCACAAAATTTCTGCAATGGCAGTTGGCGCTCAATATGGACTATCGAGTTCAAGGATGATGTACAAACAGTGGAAGTAAGAGGCAAATTTCAGGTGGGGGCCCATTACTTTGAAGAGGGCAATGTCCAATTAGATGCAAAACACGAATGCAAGGATTCAACAATATTTCAGTCGCCTGATGATTCTGCGATTTCCTTGGCCAACATTATTCGCCACCATGAGACAGAATACCTGGATGCTCTTCAGGACCTTCGAAGGAAGCTTCCAGTTACACGTACACAGTTCCCGTGGCACAATACTAAGCAGTTCAGCCTTACAAGAGATCTCACGAAAGAACTTGGAATCGGAAAGTAG

Network for GWHGAAZE019418

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01267.18	F-actin_cap_A	9	165	1.20E-36

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10364	CAPZA	Endocytosis	map04144

Gene Ontology

GO term	Ontology	Name
GO:0051016	biological_process	barbed-end actin filament capping
GO:0008290	cellular_component	F-actin capping protein complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	100.159
	SRR3591706	second leaf	50.634
	SRR3591707	mature leaf	38.579
	SRR3591708	Shoot apex	50.157
	SRR3591709	Stem	87.947
	SRR3591710	White floral bud	70.366
	SRR3591711	White flower	70.529
	SRR3591712	Green floral bud	45.373
	SRR3591713	Yellow flower	73.091
SRP173429	SRR8316895	Juvenile bud stage	35.265
	SRR8316896	Juvenile bud stage	32.601
	SRR8316897	Juvenile bud stage	20.649
	SRR8316894	Third green stage	12.668
	SRR8316900	Third green stage	42.760
	SRR8316901	Third green stage	40.827
	SRR8316898	Complete white stage	33.092
	SRR8316899	Complete white stage	41.592
	SRR8316903	Complete white stage	42.408
	SRR8316902	Silver flowering stage	35.840
	SRR8316904	Silver flowering stage	50.713
	SRR8316905	Silver flowering stage	25.302
	SRR8316906	Gold flowering stage	77.037
	SRR8316907	Gold flowering stage	70.740
	SRR8316908	Gold flowering stage	68.156
SRP132670	SRR6706286	Control	51.987
	SRR6706287	Light intensity 50%	53.541
	SRR6706288	Light intensity 20%	55.659
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	41.555
	CNS0095593	Slightly white alabastrum(diploid) 2	44.231
	CNS0095594	Slightly white alabastrum(diploid) 3	42.839
	CNS0095595	Whole white alabastrum(diploid) 2	37.821
	CNS0095596	Whole white alabastrum(diploid) 3	40.018
	CNS0095597	Whole white alabastrum(diploid) 4	38.501
	CNS0095598	Silvery flower (diploied) 1	41.758
	CNS0095599	Silvery flower (diploied) 2	52.425
	CNS0095600	Silvery flower (diploied) 3	64.200
	CNS0095601	Golden flower (diploid) 1	34.038
	CNS0095602	Golden flower (diploid) 2	45.857
	CNS0095603	Golden flower (diploid) 3	41.096
	CNS0095604	Slightly white alabastrum(tetraploid) 1	44.069
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.697
	CNS0095606	Slightly white alabastrum(tetraploid) 3	57.902
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.714
	CNS0095608	Whole white alabastrum(tetraploid) 2	36.191
	CNS0095609	Whole white alabastrum(tetraploid) 3	34.159
	CNS0095610	Silvery flower (tetraploid) 1	55.630
	CNS0095611	Silvery flower (tetraploid) 2	54.644
	CNS0095612	Silvery flower (tetraploid) 3	79.504
	CNS0095613	Golden flower (tetraploid) 1	45.780
	CNS0095614	Golden flower (tetraploid) 2	54.299
	CNS0095615	Golden flower (tetraploid) 3	46.740
CRA001975	CRR073297	Stem 1	68.692
	CRR073298	Stem 2	57.422
	CRR073299	Stem 3	42.221
	CRR073300	Leaf 1	52.438
	CRR073301	Leaf 2	59.811
	CRR073302	Leaf 3	55.082
	CRR073303	Juvenile bud 1	49.035
	CRR073304	Juvenile bud 2	50.268
	CRR073305	Juvenile bud 3	43.602
	CRR073306	Third green 1	92.224
	CRR073307	Third green 2	86.888
	CRR073308	Third green 3	91.185
	CRR073309	Second white 1	58.703
	CRR073310	Second white 2	83.285
	CRR073311	Second white 3	57.797
	CRR073312	Silver flowering 1	53.649
	CRR073313	Silver flowering 2	46.490
	CRR073314	Silver flowering 3	42.104
	CRR073315	Gold flowering 1	36.217
	CRR073316	Gold flowering 2	49.546
	CRR073317	Gold flowering 3	22.273
	CRR073318	Tawny withering 1	75.609
	CRR073319	Tawny withering 2	78.595
	CRR073320	Tawny withering 3	96.638