Gene detail

Detail information of GWHGAAZE019193

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI39581.3	4.3094E-58	unnamed protein product [Vitis vinifera]
Swissprot	tr\|O04834\|SAR1A_ARATH	3E-58	GTP-binding protein SAR1A
trEMBL	tr\|W9QX75\|W9QX75_9ROSA	8E-58	GTP-binding protein {ECO:0000313\|EMBL:EXB47144.1}
TAIR10	AT4G02080.1	2E-46	secretion-associated RAS super family 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	33599627	33600586	-
GWHAAZE00000005	mRNA	33599627	33600586	-
GWHAAZE00000005	exon	33599627	33599764	-
GWHAAZE00000005	exon	33600458	33600586	-
GWHAAZE00000005	CDS	33600458	33600586	-
GWHAAZE00000005	CDS	33599627	33599764	-

Transcript Sequence
>GWHTAAZE019215 ATGTTTTTGCTGGATTGGTTCTACGGAGTGCTCGCATCGCTCGGTTTGTGGCAGAAAGAGGCCAAGATCTTGTTCTTAGGGCTCGATAATGCCGGCAAAACCACGTTGTTGCATATGTTGAAAGATGAGAGATTGGTTCAACACCAGCCAACCCAGTATCCAACATCTGAGGAGTTGAGTATTGGGAAAATCAAGTTCAAGGCTTTTGATTTGGGAGGACATCAGATTGCCCGAAGAGTGTGGAAAGATTACTACGCCAAGGTATAG

Network for GWHGAAZE019193

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00025.22	Arf	8	88	1.40E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07953	SAR1	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0006886	biological_process	intracellular protein transport
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	347.569
	SRR3591706	second leaf	246.524
	SRR3591707	mature leaf	191.024
	SRR3591708	Shoot apex	267.471
	SRR3591709	Stem	327.997
	SRR3591710	White floral bud	308.143
	SRR3591711	White flower	380.089
	SRR3591712	Green floral bud	388.241
	SRR3591713	Yellow flower	517.470
SRP173429	SRR8316895	Juvenile bud stage	211.653
	SRR8316896	Juvenile bud stage	302.547
	SRR8316897	Juvenile bud stage	124.159
	SRR8316894	Third green stage	107.853
	SRR8316900	Third green stage	385.676
	SRR8316901	Third green stage	398.371
	SRR8316898	Complete white stage	168.374
	SRR8316899	Complete white stage	556.551
	SRR8316903	Complete white stage	233.831
	SRR8316902	Silver flowering stage	263.102
	SRR8316904	Silver flowering stage	291.803
	SRR8316905	Silver flowering stage	175.909
	SRR8316906	Gold flowering stage	543.515
	SRR8316907	Gold flowering stage	557.757
	SRR8316908	Gold flowering stage	518.977
SRP132670	SRR6706286	Control	389.577
	SRR6706287	Light intensity 50%	399.979
	SRR6706288	Light intensity 20%	450.802
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	271.091
	CNS0095593	Slightly white alabastrum(diploid) 2	293.291
	CNS0095594	Slightly white alabastrum(diploid) 3	243.295
	CNS0095595	Whole white alabastrum(diploid) 2	330.462
	CNS0095596	Whole white alabastrum(diploid) 3	302.932
	CNS0095597	Whole white alabastrum(diploid) 4	332.722
	CNS0095598	Silvery flower (diploied) 1	235.821
	CNS0095599	Silvery flower (diploied) 2	240.959
	CNS0095600	Silvery flower (diploied) 3	310.522
	CNS0095601	Golden flower (diploid) 1	212.563
	CNS0095602	Golden flower (diploid) 2	384.816
	CNS0095603	Golden flower (diploid) 3	352.405
	CNS0095604	Slightly white alabastrum(tetraploid) 1	246.103
	CNS0095605	Slightly white alabastrum(tetraploid) 2	247.575
	CNS0095606	Slightly white alabastrum(tetraploid) 3	271.542
	CNS0095607	Whole white alabastrum(tetraploid) 1	263.594
	CNS0095608	Whole white alabastrum(tetraploid) 2	262.559
	CNS0095609	Whole white alabastrum(tetraploid) 3	238.793
	CNS0095610	Silvery flower (tetraploid) 1	261.864
	CNS0095611	Silvery flower (tetraploid) 2	234.431
	CNS0095612	Silvery flower (tetraploid) 3	287.071
	CNS0095613	Golden flower (tetraploid) 1	284.615
	CNS0095614	Golden flower (tetraploid) 2	264.142
	CNS0095615	Golden flower (tetraploid) 3	362.514
CRA001975	CRR073297	Stem 1	353.817
	CRR073298	Stem 2	386.246
	CRR073299	Stem 3	430.378
	CRR073300	Leaf 1	535.109
	CRR073301	Leaf 2	521.755
	CRR073302	Leaf 3	597.367
	CRR073303	Juvenile bud 1	706.209
	CRR073304	Juvenile bud 2	671.022
	CRR073305	Juvenile bud 3	471.753
	CRR073306	Third green 1	565.852
	CRR073307	Third green 2	589.796
	CRR073308	Third green 3	502.197
	CRR073309	Second white 1	942.689
	CRR073310	Second white 2	666.565
	CRR073311	Second white 3	618.729
	CRR073312	Silver flowering 1	925.043
	CRR073313	Silver flowering 2	1180.411
	CRR073314	Silver flowering 3	814.715
	CRR073315	Gold flowering 1	407.017
	CRR073316	Gold flowering 2	376.428
	CRR073317	Gold flowering 3	341.055
	CRR073318	Tawny withering 1	598.839
	CRR073319	Tawny withering 2	521.462
	CRR073320	Tawny withering 3	610.283