Gene detail

Detail information of GWHGAAZE019181

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009779504.1	9.29141E-52	PREDICTED: ocs element-binding factor 1-like [Nicotiana sylvestris]
Swissprot	tr\|P24068\|OCS1_MAIZE	2E-27	Ocs element-binding factor 1
trEMBL	tr\|A0A068VBR2\|A0A068VBR2_COFCA	2E-47	Coffea canephora DH200=94 genomic scaffold, scaffold_219 {ECO:0000313\|EMBL:CDP18250.1}
TAIR10	AT3G62420.1	4E-22	basic region/leucine zipper motif 53

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	33405324	33405758	-
GWHAAZE00000005	mRNA	33405324	33405758	-
GWHAAZE00000005	exon	33405324	33405758	-
GWHAAZE00000005	CDS	33405324	33405758	-

Transcript Sequence
>GWHTAAZE019203 ATGTCGAATTTGAGGCCAACTGGCAGTAGCTCTACATCCGAGGGGGACCTGAGGTACGCAATGATGGATGAGAAGAAGAGGAAAAGGATGATTTCGAATAGAGAATCTGCTAGGCGGTCGAGGATGAAGAAGCAAAAACTTGTGCAAAATATGGCCGAAGAGATAAATCGGCTGCAAATGGCGAACAAGGATATTGTTAATAAAATTGACTCAACCGCACAAGTTTATATGATGTATAAGGCAGAGAATGATGTATTGAGGGCTCAAGAAATGGAATTGGCTGAGAGATTGAGGTCCTTGAATGATATTTTGAAGAATAGTGGGATGATGGATGAGGAGATTCTTGAATTGCCTGATCCTCTGTTGAGACCGTGGCAGCTTCCATTCACTGCGCAGCAGCCAATCGCTGCTTCTTCCGGGTTGTTTCATTTCTAA

Network for GWHGAAZE019181

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	25	76	6.50E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	49.171
	SRR3591706	second leaf	38.387
	SRR3591707	mature leaf	37.813
	SRR3591708	Shoot apex	55.789
	SRR3591709	Stem	81.018
	SRR3591710	White floral bud	59.967
	SRR3591711	White flower	88.360
	SRR3591712	Green floral bud	58.696
	SRR3591713	Yellow flower	114.738
SRP173429	SRR8316895	Juvenile bud stage	30.290
	SRR8316896	Juvenile bud stage	38.608
	SRR8316897	Juvenile bud stage	22.962
	SRR8316894	Third green stage	18.054
	SRR8316900	Third green stage	51.533
	SRR8316901	Third green stage	62.028
	SRR8316898	Complete white stage	21.713
	SRR8316899	Complete white stage	76.452
	SRR8316903	Complete white stage	28.796
	SRR8316902	Silver flowering stage	33.350
	SRR8316904	Silver flowering stage	45.563
	SRR8316905	Silver flowering stage	21.752
	SRR8316906	Gold flowering stage	69.684
	SRR8316907	Gold flowering stage	68.046
	SRR8316908	Gold flowering stage	67.508
SRP132670	SRR6706286	Control	49.737
	SRR6706287	Light intensity 50%	43.854
	SRR6706288	Light intensity 20%	44.235
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	46.628
	CNS0095593	Slightly white alabastrum(diploid) 2	55.710
	CNS0095594	Slightly white alabastrum(diploid) 3	61.037
	CNS0095595	Whole white alabastrum(diploid) 2	51.892
	CNS0095596	Whole white alabastrum(diploid) 3	50.292
	CNS0095597	Whole white alabastrum(diploid) 4	49.534
	CNS0095598	Silvery flower (diploied) 1	59.892
	CNS0095599	Silvery flower (diploied) 2	69.182
	CNS0095600	Silvery flower (diploied) 3	66.678
	CNS0095601	Golden flower (diploid) 1	63.847
	CNS0095602	Golden flower (diploid) 2	74.632
	CNS0095603	Golden flower (diploid) 3	73.796
	CNS0095604	Slightly white alabastrum(tetraploid) 1	55.795
	CNS0095605	Slightly white alabastrum(tetraploid) 2	57.633
	CNS0095606	Slightly white alabastrum(tetraploid) 3	70.195
	CNS0095607	Whole white alabastrum(tetraploid) 1	48.463
	CNS0095608	Whole white alabastrum(tetraploid) 2	50.292
	CNS0095609	Whole white alabastrum(tetraploid) 3	52.364
	CNS0095610	Silvery flower (tetraploid) 1	84.810
	CNS0095611	Silvery flower (tetraploid) 2	72.458
	CNS0095612	Silvery flower (tetraploid) 3	78.719
	CNS0095613	Golden flower (tetraploid) 1	93.179
	CNS0095614	Golden flower (tetraploid) 2	91.937
	CNS0095615	Golden flower (tetraploid) 3	94.772
CRA001975	CRR073297	Stem 1	22.235
	CRR073298	Stem 2	24.614
	CRR073299	Stem 3	23.686
	CRR073300	Leaf 1	27.906
	CRR073301	Leaf 2	29.384
	CRR073302	Leaf 3	25.946
	CRR073303	Juvenile bud 1	24.525
	CRR073304	Juvenile bud 2	27.213
	CRR073305	Juvenile bud 3	13.573
	CRR073306	Third green 1	15.713
	CRR073307	Third green 2	16.974
	CRR073308	Third green 3	12.509
	CRR073309	Second white 1	10.085
	CRR073310	Second white 2	26.538
	CRR073311	Second white 3	19.513
	CRR073312	Silver flowering 1	20.290
	CRR073313	Silver flowering 2	10.633
	CRR073314	Silver flowering 3	12.987
	CRR073315	Gold flowering 1	11.639
	CRR073316	Gold flowering 2	13.769
	CRR073317	Gold flowering 3	8.282
	CRR073318	Tawny withering 1	26.714
	CRR073319	Tawny withering 2	31.132
	CRR073320	Tawny withering 3	26.608