Gene detail

Detail information of GWHGAAZE018993

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007223177.1	1.2708E-123	hypothetical protein PRUPE_ppa009157mg [Prunus persica]
trEMBL	tr\|M5XFY1\|M5XFY1_PRUPE	5E-124	Uncharacterized protein {ECO:0000313\|EMBL:EMJ24376.1}
TAIR10	AT2G02570.4	1E-75	nucleic acid binding;RNA binding

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	28417847	28420922	-
GWHAAZE00000005	mRNA	28417847	28420922	-
GWHAAZE00000005	exon	28417847	28418020	-
GWHAAZE00000005	exon	28418383	28418511	-
GWHAAZE00000005	exon	28419575	28419766	-
GWHAAZE00000005	exon	28420672	28420747	-
GWHAAZE00000005	exon	28420852	28420922	-
GWHAAZE00000005	CDS	28420852	28420922	-
GWHAAZE00000005	CDS	28420672	28420747	-
GWHAAZE00000005	CDS	28419575	28419766	-
GWHAAZE00000005	CDS	28418383	28418511	-
GWHAAZE00000005	CDS	28417847	28418020	-

Transcript Sequence
>GWHTAAZE019015 ATGTCTGATTATTCTGACAAGCTTCCTGTTGGCACTAAAGTTCAAGCTGTTTGGAGCGACGATGGAGAATGGTACAATGCTACTATTGAGGCACATACACCAAATGGGTATTTTGTGCATTACGATGGATGGGGCAATAAGGAAGAGGTTGATCCTGCTAATGTTAGGCCAATAAGAGAAGGTGCCGTTGATGCTCTTCTGGAGGCTGAAAAGGAAGCCGAGGCTACTAGGCAAGCTCTTAAACGTAAGATTGCAAAAGCTGCTGCTGCTGACTCTGATTTCCACTCACGTAGTTTACCGGTGAAGCTTCGTATTGAACCTGCTGACCTCGAAGATGTGAAAGCGGCCAAACGTAAGAAGATACATGCATTTAAGTCAAAGATGAGGATGGAGCAACTTGAGGTGACACAGAACAAGAGGCAGAATGCTTGGCAGCAATTCCAAACCACCAAAGGCCGGGCTAAGAAGATTGGGTTCTTCTCGGGGAGGAAGAGGGAAAGTATATTCAAGTCACCAGACGATCCATTTGGGAAAGTAGGGGTGACGGGAAGTGGGAAAGGTTTGACGGAGTTTCAGAAGAGGGAAAAACACTTGCATCTCAAGGGAGGTGGATCAAACTCTGCTGATGCTACCGATGAATAG

Network for GWHGAAZE018993

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06003.13	SMN	8	69	3.30E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12839	SMNDC1, SPF30	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0006397	biological_process	mRNA processing
GO:0005634	cellular_component	nucleus
GO:0005737	cellular_component	cytoplasm
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.542
	SRR3591706	second leaf	8.488
	SRR3591707	mature leaf	14.997
	SRR3591708	Shoot apex	13.120
	SRR3591709	Stem	12.137
	SRR3591710	White floral bud	9.440
	SRR3591711	White flower	13.341
	SRR3591712	Green floral bud	8.565
	SRR3591713	Yellow flower	18.339
SRP173429	SRR8316895	Juvenile bud stage	3.422
	SRR8316896	Juvenile bud stage	7.213
	SRR8316897	Juvenile bud stage	3.059
	SRR8316894	Third green stage	2.028
	SRR8316900	Third green stage	5.372
	SRR8316901	Third green stage	5.418
	SRR8316898	Complete white stage	2.535
	SRR8316899	Complete white stage	5.572
	SRR8316903	Complete white stage	4.180
	SRR8316902	Silver flowering stage	3.585
	SRR8316904	Silver flowering stage	3.576
	SRR8316905	Silver flowering stage	2.229
	SRR8316906	Gold flowering stage	5.908
	SRR8316907	Gold flowering stage	4.584
	SRR8316908	Gold flowering stage	7.470
SRP132670	SRR6706286	Control	5.978
	SRR6706287	Light intensity 50%	5.534
	SRR6706288	Light intensity 20%	6.212
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.802
	CNS0095593	Slightly white alabastrum(diploid) 2	3.220
	CNS0095594	Slightly white alabastrum(diploid) 3	5.038
	CNS0095595	Whole white alabastrum(diploid) 2	4.324
	CNS0095596	Whole white alabastrum(diploid) 3	5.435
	CNS0095597	Whole white alabastrum(diploid) 4	5.139
	CNS0095598	Silvery flower (diploied) 1	3.942
	CNS0095599	Silvery flower (diploied) 2	4.665
	CNS0095600	Silvery flower (diploied) 3	2.589
	CNS0095601	Golden flower (diploid) 1	5.621
	CNS0095602	Golden flower (diploid) 2	2.733
	CNS0095603	Golden flower (diploid) 3	3.142
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.148
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.568
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.239
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.768
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.417
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.172
	CNS0095610	Silvery flower (tetraploid) 1	4.069
	CNS0095611	Silvery flower (tetraploid) 2	3.483
	CNS0095612	Silvery flower (tetraploid) 3	4.929
	CNS0095613	Golden flower (tetraploid) 1	5.772
	CNS0095614	Golden flower (tetraploid) 2	5.940
	CNS0095615	Golden flower (tetraploid) 3	4.054
CRA001975	CRR073297	Stem 1	7.183
	CRR073298	Stem 2	5.185
	CRR073299	Stem 3	3.062
	CRR073300	Leaf 1	5.817
	CRR073301	Leaf 2	5.745
	CRR073302	Leaf 3	2.718
	CRR073303	Juvenile bud 1	2.089
	CRR073304	Juvenile bud 2	1.352
	CRR073305	Juvenile bud 3	1.761
	CRR073306	Third green 1	0.752
	CRR073307	Third green 2	1.350
	CRR073308	Third green 3	1.131
	CRR073309	Second white 1	0.169
	CRR073310	Second white 2	2.094
	CRR073311	Second white 3	1.112
	CRR073312	Silver flowering 1	1.642
	CRR073313	Silver flowering 2	0.218
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.776
	CRR073316	Gold flowering 2	5.724
	CRR073317	Gold flowering 3	0.396
	CRR073318	Tawny withering 1	4.627
	CRR073319	Tawny withering 2	2.720
	CRR073320	Tawny withering 3	4.094