Gene detail

Detail information of GWHGAAZE018983

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006385082.1	9.62313E-81	hypothetical protein POPTR_0004s23730g [Populus trichocarpa]
Swissprot	tr\|Q9SY74\|C3H5_ARATH	5E-67	Zinc finger CCCH domain-containing protein 5
trEMBL	tr\|U5GKZ8\|U5GKZ8_POPTR	4E-81	Uncharacterized protein {ECO:0000313\|EMBL:ERP62879.1}
TAIR10	AT1G10320.1	3E-51	Zinc finger C-x8-C-x5-C-x3-H type family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	28258339	28259695	+
GWHAAZE00000005	mRNA	28258339	28259695	+
GWHAAZE00000005	exon	28258339	28258491	+
GWHAAZE00000005	exon	28258635	28258772	+
GWHAAZE00000005	exon	28258877	28259065	+
GWHAAZE00000005	exon	28259552	28259695	+
GWHAAZE00000005	CDS	28258339	28258491	+
GWHAAZE00000005	CDS	28258635	28258772	+
GWHAAZE00000005	CDS	28258877	28259065	+
GWHAAZE00000005	CDS	28259552	28259695	+

Transcript Sequence
>GWHTAAZE019005 TCCAATCTTGAGAATGAGTCAAATGAAGATGATGATTGGGAATATGTAGAAGAGGGGCCTCCCGAAATTATTTGGCAAGGAAATGAAATAATTGTTAAGAAAAAAAGAGTAAAGGTGAAAAAGAAAATTGTTGACAATCAGCCCAACAAAGAGGACGCTGATAGGCCTATCTCAAATCCTCTTCCTCCACAATCTGAAGCCTTTGCTGATTACAAGAGTACTCCTATTGTTTCAGCCCAACAGCTGTTGGACAATGTTGCTCAGCAAGTCCCTAACTTTGGAACAGAACAAGATAAAGCTCATTGTCCATTTCACATCAAAACTGGAGCATGTCGGTTTGGCTCACGTTGCAGCAGAGTCCACTTTTACCCTGATAAATCTTGCACGCTACTTTTCAAGAACATGTATAATGGACCTGGCCTTGCTTGGGAGCAGGATGAGGGGCTTGAGGTCTGTAAAATGAAGTCTACCATGATTCTAACTTCTTCTCAAGATTCACTTCGATGGAGGTTCACTGTTTTGGCCTTGGTTTGGTTAGAGACAAAAGATATTAGCAAGTCTGTATCCTACATGCTGCAATTTGAGTGCCATTATTCTAGAACCTTCCCATTATCAATGTATTGA

Network for GWHGAAZE018983

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00642.25	zf-CCCH	101	121	0.00012

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C3H

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0000398	biological_process	mRNA splicing, via spliceosome
GO:0089701	cellular_component	U2AF
GO:0046872	molecular_function	metal ion binding
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.895
	SRR3591706	second leaf	3.974
	SRR3591707	mature leaf	5.755
	SRR3591708	Shoot apex	5.505
	SRR3591709	Stem	8.954
	SRR3591710	White floral bud	6.929
	SRR3591711	White flower	9.516
	SRR3591712	Green floral bud	6.448
	SRR3591713	Yellow flower	6.613
SRP173429	SRR8316895	Juvenile bud stage	3.766
	SRR8316896	Juvenile bud stage	4.625
	SRR8316897	Juvenile bud stage	2.451
	SRR8316894	Third green stage	2.724
	SRR8316900	Third green stage	3.814
	SRR8316901	Third green stage	3.890
	SRR8316898	Complete white stage	1.026
	SRR8316899	Complete white stage	5.037
	SRR8316903	Complete white stage	2.182
	SRR8316902	Silver flowering stage	2.036
	SRR8316904	Silver flowering stage	4.010
	SRR8316905	Silver flowering stage	0.757
	SRR8316906	Gold flowering stage	3.772
	SRR8316907	Gold flowering stage	4.873
	SRR8316908	Gold flowering stage	5.469
SRP132670	SRR6706286	Control	3.772
	SRR6706287	Light intensity 50%	3.170
	SRR6706288	Light intensity 20%	3.898
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.681
	CNS0095593	Slightly white alabastrum(diploid) 2	1.757
	CNS0095594	Slightly white alabastrum(diploid) 3	3.488
	CNS0095595	Whole white alabastrum(diploid) 2	2.159
	CNS0095596	Whole white alabastrum(diploid) 3	0.473
	CNS0095597	Whole white alabastrum(diploid) 4	1.430
	CNS0095598	Silvery flower (diploied) 1	7.431
	CNS0095599	Silvery flower (diploied) 2	5.520
	CNS0095600	Silvery flower (diploied) 3	3.963
	CNS0095601	Golden flower (diploid) 1	2.123
	CNS0095602	Golden flower (diploid) 2	3.604
	CNS0095603	Golden flower (diploid) 3	4.088
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.366
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.585
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.374
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.640
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.273
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.983
	CNS0095610	Silvery flower (tetraploid) 1	7.289
	CNS0095611	Silvery flower (tetraploid) 2	5.236
	CNS0095612	Silvery flower (tetraploid) 3	3.901
	CNS0095613	Golden flower (tetraploid) 1	3.279
	CNS0095614	Golden flower (tetraploid) 2	5.898
	CNS0095615	Golden flower (tetraploid) 3	4.141
CRA001975	CRR073297	Stem 1	3.913
	CRR073298	Stem 2	4.504
	CRR073299	Stem 3	0.961
	CRR073300	Leaf 1	4.185
	CRR073301	Leaf 2	3.760
	CRR073302	Leaf 3	0.713
	CRR073303	Juvenile bud 1	0.978
	CRR073304	Juvenile bud 2	0.363
	CRR073305	Juvenile bud 3	1.215
	CRR073306	Third green 1	0.214
	CRR073307	Third green 2	0.191
	CRR073308	Third green 3	0.221
	CRR073309	Second white 1	0.437
	CRR073310	Second white 2	0.590
	CRR073311	Second white 3	0.539
	CRR073312	Silver flowering 1	0.108
	CRR073313	Silver flowering 2	0.129
	CRR073314	Silver flowering 3	0.991
	CRR073315	Gold flowering 1	0.205
	CRR073316	Gold flowering 2	0.715
	CRR073317	Gold flowering 3	0.086
	CRR073318	Tawny withering 1	1.643
	CRR073319	Tawny withering 2	3.238
	CRR073320	Tawny withering 3	2.680