Gene detail

Detail information of GWHGAAZE018877

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009786187.1	1.14922E-45	PREDICTED: serine/threonine-protein kinase-like protein At5g23170 [Nicotiana sylvestris]
Swissprot	tr\|Q9SGN7\|CCR12_ARATH	2E-17	Serine/threonine-protein kinase-like protein At1g28390
trEMBL	tr\|F6HK56\|F6HK56_VITVI	2E-43	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB55059.1}
TAIR10	AT1G28390.1	2E-11	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	26069013	26069952	-
GWHAAZE00000005	mRNA	26069013	26069952	-
GWHAAZE00000005	exon	26069013	26069257	-
GWHAAZE00000005	exon	26069604	26069952	-
GWHAAZE00000005	CDS	26069604	26069952	-
GWHAAZE00000005	CDS	26069013	26069257	-

Transcript Sequence
>GWHTAAZE018899 ATGAATGAATTTGAATACCAAGAGCTTGAAGAGGCTACAAAGAACTTCTCTTCTTCTTGTCTCATAGCCAAAGGAAGCCATGGATGTGTCTATGAAGGCATTCTCAAAGATGGCAAGCGGGTAGCGATAAAGAAGCAATCTTTGGGGCTTAAAAAACTCGAAGATAACTCGAAGCTCAACAACGAAGTCTCTATCTTATCATCACTCCCTTCAAACTCTTATTCGATCAACCTTGTTGGGACAAGTCAAGACTCGACCAACAACAAGGTACTTGTCATGGAACACATGCCAAATGGCACACTCCATGATATGCTTCACGTAGTTCCTGTGCCACCACCGTGGCCTAAACAATGGGCAATACAATTGATCGATGTCGATGAAGCATTAGAAATCTGTGACAAAAGGGTGACAATGCCACGGTACATGGAGGGCACAATCAGACGGATTTTAGAGATAGCAGCACTTTGCGTGTCATCCAAGGAAGACCATCGGCCGTCAATAGGCGAAGTTGTTATTGAAATAGAAAATTGTTTAGTATTTGAACGGCCTGGTTTCCTATATGGCTTAATCCTCTTCGAAGCCTTATTCTTTTAA

Network for GWHGAAZE018877

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	22	106	5.80E-09

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_CR4L

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.746
	SRR3591706	second leaf	0.891
	SRR3591707	mature leaf	0.767
	SRR3591708	Shoot apex	1.505
	SRR3591709	Stem	0.268
	SRR3591710	White floral bud	0.564
	SRR3591711	White flower	0.189
	SRR3591712	Green floral bud	0.639
	SRR3591713	Yellow flower	0.209
SRP173429	SRR8316895	Juvenile bud stage	1.761
	SRR8316896	Juvenile bud stage	0.375
	SRR8316897	Juvenile bud stage	0.736
	SRR8316894	Third green stage	0.881
	SRR8316900	Third green stage	3.178
	SRR8316901	Third green stage	3.341
	SRR8316898	Complete white stage	0.603
	SRR8316899	Complete white stage	1.737
	SRR8316903	Complete white stage	0.913
	SRR8316902	Silver flowering stage	0.656
	SRR8316904	Silver flowering stage	0.071
	SRR8316905	Silver flowering stage	0.157
	SRR8316906	Gold flowering stage	0.158
	SRR8316907	Gold flowering stage	0.375
	SRR8316908	Gold flowering stage	0.086
SRP132670	SRR6706286	Control	3.107
	SRR6706287	Light intensity 50%	2.389
	SRR6706288	Light intensity 20%	2.426
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.543
	CNS0095593	Slightly white alabastrum(diploid) 2	2.479
	CNS0095594	Slightly white alabastrum(diploid) 3	0.853
	CNS0095595	Whole white alabastrum(diploid) 2	3.060
	CNS0095596	Whole white alabastrum(diploid) 3	1.440
	CNS0095597	Whole white alabastrum(diploid) 4	1.016
	CNS0095598	Silvery flower (diploied) 1	0.908
	CNS0095599	Silvery flower (diploied) 2	0.075
	CNS0095600	Silvery flower (diploied) 3	0.264
	CNS0095601	Golden flower (diploid) 1	0.566
	CNS0095602	Golden flower (diploid) 2	0.240
	CNS0095603	Golden flower (diploid) 3	0.321
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.501
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.869
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.711
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.504
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.421
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.085
	CNS0095610	Silvery flower (tetraploid) 1	0.063
	CNS0095611	Silvery flower (tetraploid) 2	0.301
	CNS0095612	Silvery flower (tetraploid) 3	0.627
	CNS0095613	Golden flower (tetraploid) 1	0.534
	CNS0095614	Golden flower (tetraploid) 2	0.522
	CNS0095615	Golden flower (tetraploid) 3	0.053
CRA001975	CRR073297	Stem 1	4.479
	CRR073298	Stem 2	3.871
	CRR073299	Stem 3	5.374
	CRR073300	Leaf 1	3.313
	CRR073301	Leaf 2	4.914
	CRR073302	Leaf 3	3.649
	CRR073303	Juvenile bud 1	5.054
	CRR073304	Juvenile bud 2	1.806
	CRR073305	Juvenile bud 3	5.097
	CRR073306	Third green 1	2.117
	CRR073307	Third green 2	0.826
	CRR073308	Third green 3	1.313
	CRR073309	Second white 1	0.190
	CRR073310	Second white 2	0.262
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.227
	CRR073313	Silver flowering 2	0.206
	CRR073314	Silver flowering 3	0.069
	CRR073315	Gold flowering 1	0.617
	CRR073316	Gold flowering 2	0.333
	CRR073317	Gold flowering 3	0.741
	CRR073318	Tawny withering 1	0.783
	CRR073319	Tawny withering 2	0.810
	CRR073320	Tawny withering 3	1.321