Gene detail

Detail information of GWHGAAZE018847

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007213720.1	1.55998E-24	hypothetical protein PRUPE_ppa000416mg [Prunus persica]
Swissprot	tr\|Q8L840\|RQL4A_ARATH	7E-25	ATP-dependent DNA helicase Q-like 4A
trEMBL	tr\|M5WMH6\|M5WMH6_PRUPE	6E-25	Uncharacterized protein {ECO:0000313\|EMBL:EMJ14919.1}
TAIR10	AT1G10930.1	8E-17	DNA helicase (RECQl4A)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	25446734	25448557	-
GWHAAZE00000005	mRNA	25446734	25448557	-
GWHAAZE00000005	exon	25448424	25448557	-
GWHAAZE00000005	exon	25447327	25447498	-
GWHAAZE00000005	exon	25446734	25446778	-
GWHAAZE00000005	CDS	25448424	25448557	-
GWHAAZE00000005	CDS	25447327	25447498	-
GWHAAZE00000005	CDS	25446734	25446778	-

Transcript Sequence
>GWHTAAZE018869 ATGGATATCCTGTTACAACCATCTTCTCAAGTTTCCATTTTTATCTCTTGCTTTAGAAACGCTACATTGCAGCAACTGAGCATCAGAATACCCAGAAACAAGGAAGAACTTCTTGAGATCAATGGCATGGGCAAGGGAAGGGTAGAAAAGTATGGAGACCAGGTGTTGAAGACGATAGAGGCTACCATCAAGAAACACTACAACACGGACAAAAACAGTAGCGGTAGTAATGACAGCATCGACTCTGGGAAGAGAAGAAAAGCTGATGACGACTTTGCTGAAAGCGCAGCCAAAACTAAGAAAAGATCGCCTTTTGGAACTTTGGCGATGGTTGGAAATAATAAAGTTTGA

Network for GWHGAAZE018847

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00570.24	HRDC	18	59	2.50E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10901	BLM, RECQL3, SGS1	Homologous recombination	map03440
K10901	BLM, RECQL3, SGS1	Fanconi anemia pathway	map03460

Gene Ontology

GO term	Ontology	Name
GO:0044237	biological_process	cellular metabolic process
GO:0000166	molecular_function	nucleotide binding
GO:0003824	molecular_function	catalytic activity
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.472
	SRR3591706	second leaf	6.224
	SRR3591707	mature leaf	5.446
	SRR3591708	Shoot apex	25.876
	SRR3591709	Stem	7.451
	SRR3591710	White floral bud	2.224
	SRR3591711	White flower	2.244
	SRR3591712	Green floral bud	3.987
	SRR3591713	Yellow flower	2.495
SRP173429	SRR8316895	Juvenile bud stage	3.709
	SRR8316896	Juvenile bud stage	2.875
	SRR8316897	Juvenile bud stage	3.124
	SRR8316894	Third green stage	1.004
	SRR8316900	Third green stage	2.440
	SRR8316901	Third green stage	2.340
	SRR8316898	Complete white stage	1.215
	SRR8316899	Complete white stage	3.336
	SRR8316903	Complete white stage	1.183
	SRR8316902	Silver flowering stage	0.546
	SRR8316904	Silver flowering stage	0.703
	SRR8316905	Silver flowering stage	0.352
	SRR8316906	Gold flowering stage	2.009
	SRR8316907	Gold flowering stage	1.196
	SRR8316908	Gold flowering stage	0.937
SRP132670	SRR6706286	Control	4.549
	SRR6706287	Light intensity 50%	3.610
	SRR6706288	Light intensity 20%	3.904
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.863
	CNS0095593	Slightly white alabastrum(diploid) 2	3.842
	CNS0095594	Slightly white alabastrum(diploid) 3	1.738
	CNS0095595	Whole white alabastrum(diploid) 2	0.913
	CNS0095596	Whole white alabastrum(diploid) 3	0.909
	CNS0095597	Whole white alabastrum(diploid) 4	2.276
	CNS0095598	Silvery flower (diploied) 1	1.615
	CNS0095599	Silvery flower (diploied) 2	3.096
	CNS0095600	Silvery flower (diploied) 3	0.990
	CNS0095601	Golden flower (diploid) 1	3.459
	CNS0095602	Golden flower (diploid) 2	0.620
	CNS0095603	Golden flower (diploid) 3	1.361
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.501
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.709
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.253
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.383
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.854
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.181
	CNS0095610	Silvery flower (tetraploid) 1	2.422
	CNS0095611	Silvery flower (tetraploid) 2	2.193
	CNS0095612	Silvery flower (tetraploid) 3	0.365
	CNS0095613	Golden flower (tetraploid) 1	1.333
	CNS0095614	Golden flower (tetraploid) 2	0.619
	CNS0095615	Golden flower (tetraploid) 3	0.791
CRA001975	CRR073297	Stem 1	3.213
	CRR073298	Stem 2	4.629
	CRR073299	Stem 3	4.125
	CRR073300	Leaf 1	2.186
	CRR073301	Leaf 2	1.271
	CRR073302	Leaf 3	0.951
	CRR073303	Juvenile bud 1	0.575
	CRR073304	Juvenile bud 2	0.376
	CRR073305	Juvenile bud 3	1.285
	CRR073306	Third green 1	0.271
	CRR073307	Third green 2	1.482
	CRR073308	Third green 3	0.286
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.162
	CRR073311	Second white 3	0.287
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.434
	CRR073315	Gold flowering 1	2.027
	CRR073316	Gold flowering 2	0.340
	CRR073317	Gold flowering 3	0.109
	CRR073318	Tawny withering 1	2.938
	CRR073319	Tawny withering 2	3.666
	CRR073320	Tawny withering 3	4.504