Gene detail

Detail information of GWHGAAZE018617

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO97271.1	2.85167E-90	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9XJ35\|CLPR1_ARATH	2E-76	ATP-dependent Clp protease proteolytic subunit-related protein 1, chloroplastic (Precursor)
trEMBL	tr\|A0A068TM43\|A0A068TM43_COFCA	1E-90	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	AT1G49970.1	3E-57	CLP protease proteolytic subunit 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	21820134	21822869	+
GWHAAZE00000005	mRNA	21820134	21822869	+
GWHAAZE00000005	exon	21820134	21820247	+
GWHAAZE00000005	exon	21820474	21820680	+
GWHAAZE00000005	exon	21820789	21820893	+
GWHAAZE00000005	exon	21820995	21821057	+
GWHAAZE00000005	exon	21822402	21822584	+
GWHAAZE00000005	exon	21822723	21822869	+
GWHAAZE00000005	CDS	21820134	21820247	+
GWHAAZE00000005	CDS	21820474	21820680	+
GWHAAZE00000005	CDS	21820789	21820893	+
GWHAAZE00000005	CDS	21820995	21821057	+
GWHAAZE00000005	CDS	21822402	21822584	+
GWHAAZE00000005	CDS	21822723	21822869	+

Transcript Sequence
>GWHTAAZE018639 ATGGACAATTTCAAGAATGTTCCTCAAAATCTTTACGGCCTTAATCCTTCACAGATGAACATGTTTATGTCAGAAGATAATCCTGTCCGCCGACAATCAGAAAGTGTTACAGAGAAAAGCATCTCATCTGCCTATAATTATTTGAACCACAATGGGATGTATACACTATCAGGCATGAACGACAGGGGTCGTTCAAAATATAGTATGAGTGCATACATGTACTCTAGAAGAGGCCGCGGAGGTTATGGAACACCTAGAACTGCTCCTCCCGATTTGCCATCTTTGCTGTTAGATGGTCGAATTGTCTATCTGGGCATGCCGATTGTACCTGCGGTTTGCGAGCTTATTTCTGCTCAATTCCTTTATTTGCATTATGAAAATGACACAAAGCCTATATATCTCTACATAAATTCAACTGGGATACAGAGTAAGAACAGAGAGATTGTTGGATCAGACACAAATGCGTTTGCCATTGCGGACTTGATGATGGCAAAAGAACTAGATATCCACAAAGAGTATCTCATAAAGCTCTTAGCCTTCGGAATTGGGAAACCAGAAGAAGTAATAGCTAAAGATATTTCGCGTGCTAATTATATGTTACCTCAAGAGGCGGTTGACTACGGCATTGCAGACAAGATAATCGAGCCTCAGGACGTTACATTTGAGAAACGGCCCGAAATAAAGCAATTAGGCAAGCGGCAACACCAGGAATCGGTCCACGGGAAGGTTCCACTGGGTCATGGTAAATCACAGAGCAGTGGCACGCACAGTGGAGCTGATACATTTGAGGGTTCAGTTGGTGTTATAGCTGTAATGTGA

Network for GWHGAAZE018617

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	94	162	2.60E-07
PF00574.24	CLP_protease	163	216	1.00E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	101.475
	SRR3591706	second leaf	154.900
	SRR3591707	mature leaf	259.491
	SRR3591708	Shoot apex	120.211
	SRR3591709	Stem	98.211
	SRR3591710	White floral bud	360.826
	SRR3591711	White flower	669.409
	SRR3591712	Green floral bud	227.728
	SRR3591713	Yellow flower	760.466
SRP173429	SRR8316895	Juvenile bud stage	121.510
	SRR8316896	Juvenile bud stage	151.378
	SRR8316897	Juvenile bud stage	83.073
	SRR8316894	Third green stage	70.552
	SRR8316900	Third green stage	229.465
	SRR8316901	Third green stage	210.096
	SRR8316898	Complete white stage	142.148
	SRR8316899	Complete white stage	296.777
	SRR8316903	Complete white stage	186.573
	SRR8316902	Silver flowering stage	196.443
	SRR8316904	Silver flowering stage	302.127
	SRR8316905	Silver flowering stage	145.868
	SRR8316906	Gold flowering stage	571.479
	SRR8316907	Gold flowering stage	538.223
	SRR8316908	Gold flowering stage	579.676
SRP132670	SRR6706286	Control	195.690
	SRR6706287	Light intensity 50%	204.247
	SRR6706288	Light intensity 20%	236.621
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	95.433
	CNS0095593	Slightly white alabastrum(diploid) 2	98.639
	CNS0095594	Slightly white alabastrum(diploid) 3	83.402
	CNS0095595	Whole white alabastrum(diploid) 2	89.297
	CNS0095596	Whole white alabastrum(diploid) 3	91.257
	CNS0095597	Whole white alabastrum(diploid) 4	90.323
	CNS0095598	Silvery flower (diploied) 1	150.916
	CNS0095599	Silvery flower (diploied) 2	148.467
	CNS0095600	Silvery flower (diploied) 3	378.163
	CNS0095601	Golden flower (diploid) 1	174.239
	CNS0095602	Golden flower (diploid) 2	359.623
	CNS0095603	Golden flower (diploid) 3	348.316
	CNS0095604	Slightly white alabastrum(tetraploid) 1	108.597
	CNS0095605	Slightly white alabastrum(tetraploid) 2	96.668
	CNS0095606	Slightly white alabastrum(tetraploid) 3	181.814
	CNS0095607	Whole white alabastrum(tetraploid) 1	59.221
	CNS0095608	Whole white alabastrum(tetraploid) 2	65.651
	CNS0095609	Whole white alabastrum(tetraploid) 3	182.445
	CNS0095610	Silvery flower (tetraploid) 1	417.455
	CNS0095611	Silvery flower (tetraploid) 2	439.039
	CNS0095612	Silvery flower (tetraploid) 3	507.406
	CNS0095613	Golden flower (tetraploid) 1	341.991
	CNS0095614	Golden flower (tetraploid) 2	440.428
	CNS0095615	Golden flower (tetraploid) 3	734.660
CRA001975	CRR073297	Stem 1	172.705
	CRR073298	Stem 2	147.837
	CRR073299	Stem 3	180.493
	CRR073300	Leaf 1	156.196
	CRR073301	Leaf 2	141.873
	CRR073302	Leaf 3	184.657
	CRR073303	Juvenile bud 1	193.709
	CRR073304	Juvenile bud 2	183.132
	CRR073305	Juvenile bud 3	136.505
	CRR073306	Third green 1	252.929
	CRR073307	Third green 2	164.224
	CRR073308	Third green 3	204.237
	CRR073309	Second white 1	430.168
	CRR073310	Second white 2	501.059
	CRR073311	Second white 3	469.381
	CRR073312	Silver flowering 1	502.332
	CRR073313	Silver flowering 2	496.776
	CRR073314	Silver flowering 3	496.518
	CRR073315	Gold flowering 1	371.865
	CRR073316	Gold flowering 2	476.055
	CRR073317	Gold flowering 3	276.936
	CRR073318	Tawny withering 1	125.035
	CRR073319	Tawny withering 2	124.907
	CRR073320	Tawny withering 3	121.652