Gene detail

Detail information of GWHGAAZE018585

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO47958.1	6.82749E-22	hypothetical protein CISIN_1g003209mg [Citrus sinensis]
Swissprot	tr\|Q8L7W8\|FUCO2_ARATH	4E-13	Alpha-L-fucosidase 2 (Precursor)
trEMBL	tr\|A0A067DYM8\|A0A067DYM8_CITSI	3E-22	Uncharacterized protein {ECO:0000313\|EMBL:KDO47958.1}
TAIR10	AT4G34260.1	8E-12	1,2-alpha-L-fucosidases

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	21533404	21533825	+
GWHAAZE00000005	mRNA	21533404	21533825	+
GWHAAZE00000005	exon	21533404	21533665	+
GWHAAZE00000005	exon	21533818	21533825	+
GWHAAZE00000005	CDS	21533404	21533665	+
GWHAAZE00000005	CDS	21533818	21533825	+

Transcript Sequence
>GWHTAAZE018607 AGTAGAGGGAGAAACTATATACCATTTGGAGTAGAAGAGAAAGGGAATGATGGTGGGGATTGGGATAGAGTGCGACGGCTCACAGATAGAGATTTGTGGAACTCGAGCTTGATTGGAGTAGCTGAGGCTTCTAATAAGCAGTCTCTCAAGGTTAGGTTCGGCGGGCCGGCAAAGCACTGGAGCGATGCTGTTCCGATCGGCAATGGCGGTCTCGGCGCTATGATTTGGGGCGGTGTTGCTAATGAGACTCTCAATCTCAATGAGCAGTGA

Network for GWHGAAZE018585

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF14498.7	Glyco_hyd_65N_2	53	89	1.80E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15923	AXY8, FUC95A, afcA	Other glycan degradation	map00511

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.053
	SRR3591706	second leaf	8.127
	SRR3591707	mature leaf	3.846
	SRR3591708	Shoot apex	2.845
	SRR3591709	Stem	10.245
	SRR3591710	White floral bud	15.971
	SRR3591711	White flower	25.263
	SRR3591712	Green floral bud	12.662
	SRR3591713	Yellow flower	67.922
SRP173429	SRR8316895	Juvenile bud stage	4.961
	SRR8316896	Juvenile bud stage	10.794
	SRR8316897	Juvenile bud stage	5.977
	SRR8316894	Third green stage	10.382
	SRR8316900	Third green stage	37.873
	SRR8316901	Third green stage	32.766
	SRR8316898	Complete white stage	18.396
	SRR8316899	Complete white stage	39.248
	SRR8316903	Complete white stage	32.234
	SRR8316902	Silver flowering stage	18.343
	SRR8316904	Silver flowering stage	39.016
	SRR8316905	Silver flowering stage	20.328
	SRR8316906	Gold flowering stage	64.578
	SRR8316907	Gold flowering stage	40.583
	SRR8316908	Gold flowering stage	31.977
SRP132670	SRR6706286	Control	84.299
	SRR6706287	Light intensity 50%	91.276
	SRR6706288	Light intensity 20%	93.998
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.161
	CNS0095593	Slightly white alabastrum(diploid) 2	13.319
	CNS0095594	Slightly white alabastrum(diploid) 3	12.735
	CNS0095595	Whole white alabastrum(diploid) 2	7.525
	CNS0095596	Whole white alabastrum(diploid) 3	10.323
	CNS0095597	Whole white alabastrum(diploid) 4	7.241
	CNS0095598	Silvery flower (diploied) 1	8.133
	CNS0095599	Silvery flower (diploied) 2	5.347
	CNS0095600	Silvery flower (diploied) 3	41.733
	CNS0095601	Golden flower (diploid) 1	7.168
	CNS0095602	Golden flower (diploid) 2	36.296
	CNS0095603	Golden flower (diploid) 3	33.712
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.777
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.462
	CNS0095606	Slightly white alabastrum(tetraploid) 3	45.316
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.112
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.247
	CNS0095609	Whole white alabastrum(tetraploid) 3	39.204
	CNS0095610	Silvery flower (tetraploid) 1	55.195
	CNS0095611	Silvery flower (tetraploid) 2	30.058
	CNS0095612	Silvery flower (tetraploid) 3	22.089
	CNS0095613	Golden flower (tetraploid) 1	34.176
	CNS0095614	Golden flower (tetraploid) 2	47.730
	CNS0095615	Golden flower (tetraploid) 3	56.153
CRA001975	CRR073297	Stem 1	18.804
	CRR073298	Stem 2	32.886
	CRR073299	Stem 3	13.447
	CRR073300	Leaf 1	82.702
	CRR073301	Leaf 2	68.982
	CRR073302	Leaf 3	54.441
	CRR073303	Juvenile bud 1	45.269
	CRR073304	Juvenile bud 2	41.380
	CRR073305	Juvenile bud 3	86.834
	CRR073306	Third green 1	37.945
	CRR073307	Third green 2	46.920
	CRR073308	Third green 3	37.728
	CRR073309	Second white 1	12.912
	CRR073310	Second white 2	10.071
	CRR073311	Second white 3	11.949
	CRR073312	Silver flowering 1	24.695
	CRR073313	Silver flowering 2	26.344
	CRR073314	Silver flowering 3	30.055
	CRR073315	Gold flowering 1	4.315
	CRR073316	Gold flowering 2	18.443
	CRR073317	Gold flowering 3	3.445
	CRR073318	Tawny withering 1	5.853
	CRR073319	Tawny withering 2	4.489
	CRR073320	Tawny withering 3	14.470