Gene detail

Detail information of GWHGAAZE018540

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006346432.1	3.28408E-56	PREDICTED: ethylene-responsive transcription factor ERF109-like [Solanum tuberosum]
Swissprot	tr\|Q9SZ06\|EF109_ARATH	3E-31	Ethylene-responsive transcription factor ERF109
trEMBL	tr\|M1CFE5\|M1CFE5_SOLTU	1E-56	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400066343}
TAIR10	AT4G34410.1	8E-23	redox responsive transcription factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	20925939	20926532	-
GWHAAZE00000005	mRNA	20925939	20926532	-
GWHAAZE00000005	exon	20925939	20926532	-
GWHAAZE00000005	CDS	20925939	20926532	-

Transcript Sequence
>GWHTAAZE018562 ATGGCGCCAGCGCTGCCGCCAATCTCCGAAACAGTCGACACTTGTCAGTTCTGCAGAATTAGGGGCTGTTTGGGTTGCAATTTTTTTGGGGAAGAGAAAAAGGAAAGTACTAGTAGTACTACTAATGTGATTAATAAGAAAAAGAAGAAGAATAAATACAGAGGTGTAAGGCAGAGGCCGTGGGGGAAATGGGCGGCCGAGATTCGGGACCCTAGAAAGGCGGCTCGGGTTTGGCTCGGGACATTCGAGACTGCAGAAGCGGCGGCCAGGGCTTATGACAGGGCTGCCATTGAATTCAGGGGACCGCGAGCGAAGCTGAATTTCGGGTTTTCGGATTACCCGTTGAATCAAGGGAATTCACCGCAGGCTAGGGAAATGGAAATGGAAATGGAAAAGGGAAGTAAGAGGAAGAGGGAGGTCAAGAAGGAAATGGAAGTGGAAATGAATTCTAAGGGAAAGGAAAAGGAAATTGGGGAAGTGATGATGGGGGAAGATGAGATTGAAGAATGGATGAAGATGATGTTGGTGGATTTTAATTCGAATTCCTCCTCTTCTGATTCTGCAAGTGCGCATTTTCAGTATATGCAGTACTAG

Network for GWHGAAZE018540

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	52	101	2.00E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	102.095
	SRR3591706	second leaf	14.349
	SRR3591707	mature leaf	2.861
	SRR3591708	Shoot apex	31.611
	SRR3591709	Stem	150.367
	SRR3591710	White floral bud	38.032
	SRR3591711	White flower	48.822
	SRR3591712	Green floral bud	23.151
	SRR3591713	Yellow flower	20.094
SRP173429	SRR8316895	Juvenile bud stage	120.735
	SRR8316896	Juvenile bud stage	54.993
	SRR8316897	Juvenile bud stage	65.651
	SRR8316894	Third green stage	34.833
	SRR8316900	Third green stage	52.960
	SRR8316901	Third green stage	104.796
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	165.867
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	2.226
	SRR8316904	Silver flowering stage	0.269
	SRR8316905	Silver flowering stage	4.483
	SRR8316906	Gold flowering stage	17.868
	SRR8316907	Gold flowering stage	19.209
	SRR8316908	Gold flowering stage	5.181
SRP132670	SRR6706286	Control	1.301
	SRR6706287	Light intensity 50%	1.035
	SRR6706288	Light intensity 20%	0.683
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	60.571
	CNS0095593	Slightly white alabastrum(diploid) 2	145.104
	CNS0095594	Slightly white alabastrum(diploid) 3	97.904
	CNS0095595	Whole white alabastrum(diploid) 2	77.135
	CNS0095596	Whole white alabastrum(diploid) 3	9.966
	CNS0095597	Whole white alabastrum(diploid) 4	63.624
	CNS0095598	Silvery flower (diploied) 1	300.934
	CNS0095599	Silvery flower (diploied) 2	284.082
	CNS0095600	Silvery flower (diploied) 3	68.069
	CNS0095601	Golden flower (diploid) 1	206.521
	CNS0095602	Golden flower (diploid) 2	82.903
	CNS0095603	Golden flower (diploid) 3	81.765
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.309
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.117
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.586
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	1.855
	CNS0095611	Silvery flower (tetraploid) 2	0.226
	CNS0095612	Silvery flower (tetraploid) 3	6.619
	CNS0095613	Golden flower (tetraploid) 1	0.056
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.448
CRA001975	CRR073297	Stem 1	36.212
	CRR073298	Stem 2	73.787
	CRR073299	Stem 3	53.601
	CRR073300	Leaf 1	109.391
	CRR073301	Leaf 2	168.555
	CRR073302	Leaf 3	59.944
	CRR073303	Juvenile bud 1	87.213
	CRR073304	Juvenile bud 2	97.466
	CRR073305	Juvenile bud 3	216.044
	CRR073306	Third green 1	13.854
	CRR073307	Third green 2	25.163
	CRR073308	Third green 3	8.591
	CRR073309	Second white 1	14.123
	CRR073310	Second white 2	13.278
	CRR073311	Second white 3	17.772
	CRR073312	Silver flowering 1	61.758
	CRR073313	Silver flowering 2	20.554
	CRR073314	Silver flowering 3	15.716
	CRR073315	Gold flowering 1	117.725
	CRR073316	Gold flowering 2	102.893
	CRR073317	Gold flowering 3	73.903
	CRR073318	Tawny withering 1	6.824
	CRR073319	Tawny withering 2	166.393
	CRR073320	Tawny withering 3	25.559