Gene detail

Detail information of GWHGAAZE018480

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009802684.1	7.87123E-92	PREDICTED: E3 ubiquitin-protein ligase RMA3-like [Nicotiana sylvestris]
Swissprot	tr\|Q8GUK7\|RMA3_ARATH	2E-25	E3 ubiquitin-protein ligase RMA3
trEMBL	tr\|K4D0T0\|K4D0T0_SOLLC	9E-92	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc10g051270.1.1}
TAIR10	AT1G19310.1	1E-51	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	20152186	20152821	+
GWHAAZE00000005	mRNA	20152186	20152821	+
GWHAAZE00000005	exon	20152186	20152821	+
GWHAAZE00000005	CDS	20152186	20152821	+

Transcript Sequence
>GWHTAAZE018502 ATGAATTTCGCTTGCTCAGGCGATTGTAACTCCGAAATCGGAGTTTTCGAATGCAATATATGCTTCGAATTAGCCCAAGATCCGATTGTGACTCTATGTGGTCACCTTTACTGTTGGCCCTGTCTTTACAAGTGGCTGCATTTCAATTCTTATTCCCAAGGATGCCCCGTTTGCAAAGCCCTTATTCGGGAAGAAAAATTAGTTCCTATTTATGGAAGGGGAAAATCAAGCTCGGACCAAAGGATCCGATTTGATATCCCCTGTCGCCCAACAGGTCAGCGGCCTGAAACAGCCCCCGTCCCCAGCATAAACTATTTTCGAGAAGATGAGCTCGGATCCATGGGGAGATTTATGCCAATGTCAACAGCGAGGTTTGGTAACTTAACATTATCTGCATTTTTTGGTGCTATTCCCTCGTTGTTTAACCTTCAAGTTCACGGTTTTCATGATGCCACTGTGTACGGTGCTACAAGTGGAGTCCCTTATTTGTTCTCTAGTTCATATCACGGAGGTTATGCCCATGGTTTTCATCAAGATTCATTTCAAGGGTATGGATCAAAGTCGGTCCTCAAGATCTTTATTTTGTTTCTTGGCCTTCTTATGATCCTTACCCTAATTTCGTTTTCGGCATTTTAG

Network for GWHGAAZE018480

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00097.26	zf-C3HC4	18	58	5.80E-09

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
K10666	RNF5	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	164.966
	SRR3591706	second leaf	46.904
	SRR3591707	mature leaf	20.299
	SRR3591708	Shoot apex	99.638
	SRR3591709	Stem	131.979
	SRR3591710	White floral bud	66.796
	SRR3591711	White flower	34.981
	SRR3591712	Green floral bud	59.475
	SRR3591713	Yellow flower	22.440
SRP173429	SRR8316895	Juvenile bud stage	33.624
	SRR8316896	Juvenile bud stage	35.235
	SRR8316897	Juvenile bud stage	21.603
	SRR8316894	Third green stage	13.706
	SRR8316900	Third green stage	35.761
	SRR8316901	Third green stage	32.461
	SRR8316898	Complete white stage	25.187
	SRR8316899	Complete white stage	52.907
	SRR8316903	Complete white stage	33.927
	SRR8316902	Silver flowering stage	15.841
	SRR8316904	Silver flowering stage	20.264
	SRR8316905	Silver flowering stage	10.300
	SRR8316906	Gold flowering stage	27.683
	SRR8316907	Gold flowering stage	29.041
	SRR8316908	Gold flowering stage	25.999
SRP132670	SRR6706286	Control	28.481
	SRR6706287	Light intensity 50%	24.661
	SRR6706288	Light intensity 20%	21.098
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.016
	CNS0095593	Slightly white alabastrum(diploid) 2	20.479
	CNS0095594	Slightly white alabastrum(diploid) 3	20.145
	CNS0095595	Whole white alabastrum(diploid) 2	22.274
	CNS0095596	Whole white alabastrum(diploid) 3	18.740
	CNS0095597	Whole white alabastrum(diploid) 4	14.899
	CNS0095598	Silvery flower (diploied) 1	25.206
	CNS0095599	Silvery flower (diploied) 2	29.393
	CNS0095600	Silvery flower (diploied) 3	34.982
	CNS0095601	Golden flower (diploid) 1	27.968
	CNS0095602	Golden flower (diploid) 2	40.785
	CNS0095603	Golden flower (diploid) 3	37.437
	CNS0095604	Slightly white alabastrum(tetraploid) 1	30.763
	CNS0095605	Slightly white alabastrum(tetraploid) 2	23.985
	CNS0095606	Slightly white alabastrum(tetraploid) 3	45.877
	CNS0095607	Whole white alabastrum(tetraploid) 1	24.222
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.149
	CNS0095609	Whole white alabastrum(tetraploid) 3	30.498
	CNS0095610	Silvery flower (tetraploid) 1	31.177
	CNS0095611	Silvery flower (tetraploid) 2	30.351
	CNS0095612	Silvery flower (tetraploid) 3	46.654
	CNS0095613	Golden flower (tetraploid) 1	16.647
	CNS0095614	Golden flower (tetraploid) 2	26.337
	CNS0095615	Golden flower (tetraploid) 3	32.958
CRA001975	CRR073297	Stem 1	42.687
	CRR073298	Stem 2	41.308
	CRR073299	Stem 3	54.762
	CRR073300	Leaf 1	28.035
	CRR073301	Leaf 2	33.829
	CRR073302	Leaf 3	38.349
	CRR073303	Juvenile bud 1	34.059
	CRR073304	Juvenile bud 2	29.488
	CRR073305	Juvenile bud 3	38.224
	CRR073306	Third green 1	60.870
	CRR073307	Third green 2	46.848
	CRR073308	Third green 3	46.389
	CRR073309	Second white 1	38.560
	CRR073310	Second white 2	25.086
	CRR073311	Second white 3	23.854
	CRR073312	Silver flowering 1	24.542
	CRR073313	Silver flowering 2	24.455
	CRR073314	Silver flowering 3	24.105
	CRR073315	Gold flowering 1	16.002
	CRR073316	Gold flowering 2	13.957
	CRR073317	Gold flowering 3	29.712
	CRR073318	Tawny withering 1	96.759
	CRR073319	Tawny withering 2	75.580
	CRR073320	Tawny withering 3	95.404